Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pET15b/GgVcl 884-1066 (aka Vt)
 
Resource Report
Resource Website
RRID:Addgene_46176 Vcl 884-1066 Gallus gallus Ampicillin PMID:10373448 Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site. Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin aa 884-1066 (tail domain) 2026-08-15 01:15:29 0
HA Seh1L pRK5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46331 Seh1 Homo sapiens Ampicillin PMID:23723238 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 2
pET15b/GgVcl 1-851 A50I mutation
 
Resource Report
Resource Website
RRID:Addgene_46174 Vcl 1-851 A50I Gallus gallus Ampicillin PMID:16608855 See Addgene plasmid 46172 for wild-type cloning information. The A50I mutation was introduced by QuikChange mutagenesis (Stratagene). Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin aa 1-851 A50I mutation (talin binding domain mutant in vinculin head domain) 2026-08-15 01:15:29 0
pCAG_PSD95.FingR-eGFP-CCR5TC
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46295 PSD95.FingR-eGFP-CCR5TC Homo sapiens Ampicillin PMID:23791193 Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 35
pET15b/GgVcl 1-258 A50I mutation
 
Resource Report
Resource Website
RRID:Addgene_46175 Vcl 1-258 A50I Gallus gallus Ampicillin PMID:16608855 See Addgene plasmid 46173 for wild-type cloning information. The A50I mutation was introduced by QuikChange mutagenesis (Stratagene). Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin aa 1-258 (VD1) A50I mutation; talin binding deficient 2026-08-15 01:15:30 0
pCAG_GPHN.FingR-eGFP-CCR5TC
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46296 GPHN.FingR-eGFP-CCR5TC Homo sapiens Ampicillin PMID:23791193 Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 22
pSCT-GAL93-PSPC1
 
Resource Report
Resource Website
RRID:Addgene_46321 PSPC1 Homo sapiens Ampicillin PMID:22966205 There is a stop codon before HIS tag in the vector. Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 0
HA Depdc5 pRK5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46327 Depdc5 Homo sapiens Ampicillin PMID:23723238 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Differs from Depdc5 isoform 1 by 10 amino acids starting at position 724: ILTLSAPPVV 2026-08-15 01:15:30 3
pmCIT-CFPGgVcl 1-419 control 2 FRET
 
Resource Report
Resource Website
RRID:Addgene_46283 ECFP + Vcl 1-419 Gallus gallus Kanamycin PMID:17074767 Citrine proved to be a more stable FP in vivo than YFP; CIT was used to make a second generation vinculin FRET probe (first generation control is Addgene plasmid 46277). Backbone Marker:Craig lab; Vector Backbone:pmCitrine-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin aa 1-419 2026-08-15 01:15:30 0
pmECFPN3/GgVcl 1-1066 (CFP at C term)
 
Resource Report
Resource Website
RRID:Addgene_46280 Vcl 1-1066 Gallus gallus Kanamycin PMID:15883197 A206K was introduced into pECFP-N3/V1-1066 by QC to generate pmECFP/V1066 (vinculin-monomeric ECFP) Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pECFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 0
pmECFPC1/GgVcl 1-1066 (CFP at N term)
 
Resource Report
Resource Website
RRID:Addgene_46281 Vcl 1-1066 Gallus gallus Kanamycin PMID:15883197 Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 0
pSCT-GAL93-SFPQ
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46320 SFPQ Homo sapiens Ampicillin PMID:22966205 There is a stop codon before HIS tag in the vector. Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 1
p401F/GgVcl 1-1066 (N term FLAG tag)
 
Resource Report
Resource Website
RRID:Addgene_46284 Vcl 1-1066 Gallus gallus Ampicillin Backbone Marker:described in N. Kioka. 1999. JCB 144:59-69; Vector Backbone:p401F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 0
pIhh-5A9-LUC
 
Resource Report
Resource Website
RRID:Addgene_46318 5 copies of A9 sequence from Ihh promoter Ampicillin PMID:19906842 Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene. Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 0
pEYFPC1/GgVcl 1-1066 (YFP at N term)
 
Resource Report
Resource Website
RRID:Addgene_46279 Vcl 1-1066 Gallus gallus Kanamycin PMID:15883197 Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 0
pGEX-4T-1-p19-T7-PLK1
 
Resource Report
Resource Website
RRID:Addgene_46312 p19 Tomato bushy stunt virus Ampicillin PMID:23475073 IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 0
pGEX-4T-1-p19-T7-EGFPFL
 
Resource Report
Resource Website
RRID:Addgene_46310 p19 Tomato bushy stunt virus Ampicillin PMID:23475073 IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 0
HeLa full-length MLCK-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46316 HeLa long myosin light chain kinase Homo sapiens Kanamycin PMID:15020676 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:30 2
Hela kinase-dead MLCK-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46317 HeLa long myosin light chain kinase-dead Homo sapiens Kanamycin PMID:15020676 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin E1626K 2026-08-15 01:15:30 3
pGEX-4T-1-p19-T7-GagB500
 
Resource Report
Resource Website
RRID:Addgene_46314 p19 Tomato bushy stunt virus Ampicillin PMID:23475073 IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.