Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 222 showing 4421 ~ 4440 out of 32,424 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_152527

    This resource has 1+ mentions.

http://www.addgene.org/152527

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 N (nucleocapsid)
Vector Backbone Description: Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009724397.2

Proper citation: RRID:Addgene_152527 Copy   

    • RRID:Addgene_15251

    This resource has 1+ mentions.

http://www.addgene.org/15251

Species: Homo sapiens
Genetic Insert: v-ral simian leukemia viral oncogene homolog A
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176

Proper citation: RRID:Addgene_15251 Copy   

    • RRID:Addgene_15250

    This resource has 1+ mentions.

http://www.addgene.org/15250

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, beta isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: CAACAATTGCCCTAGCACTTG

Proper citation: RRID:Addgene_15250 Copy   

    • RRID:Addgene_152437

    This resource has 1+ mentions.

http://www.addgene.org/152437

Species: Severe acute respiratory syndrome coronavirus 2
Genetic Insert: SARS-CoV-2 nsp8
Vector Backbone Description: Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: NCBI reference sequence: YP_009725304.1

Proper citation: RRID:Addgene_152437 Copy   

    • RRID:Addgene_15249

    This resource has 1+ mentions.

http://www.addgene.org/15249

Species: Homo sapiens
Genetic Insert: PP2A regulatory subunit A, alpha isoform
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540176
Comments: Target sequence: GACAACAGCACCTTGCAGAGT

Proper citation: RRID:Addgene_15249 Copy   

    • RRID:Addgene_154043

    This resource has 1+ mentions.

http://www.addgene.org/154043

Species: P. tricornutum
Genetic Insert: Terminator Pbt
Vector Backbone Description: Vector Backbone:pL0RlacZ; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin

Proper citation: RRID:Addgene_154043 Copy   

    • RRID:Addgene_154054

    This resource has 1+ mentions.

http://www.addgene.org/154054

Species: Synthetic
Genetic Insert: TQM IL13 CAR
Vector Backbone Description: Vector Backbone:pXL001; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32405577

Proper citation: RRID:Addgene_154054 Copy   

    • RRID:Addgene_154103

    This resource has 1+ mentions.

http://www.addgene.org/154103

Species: Homo sapiens
Genetic Insert: Angiotensin-converting enzyme 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32753553
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint.

Proper citation: RRID:Addgene_154103 Copy   

    • RRID:Addgene_154106

    This resource has 1+ mentions.

http://www.addgene.org/154106

Species: Homo sapiens
Genetic Insert: Angiotensin-converting enzyme 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32753553
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint.

Proper citation: RRID:Addgene_154106 Copy   

    • RRID:Addgene_154101

    This resource has 1+ mentions.

http://www.addgene.org/154101

Species: Homo sapiens
Genetic Insert: Angiotensin-converting enzyme 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32753553
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint.

Proper citation: RRID:Addgene_154101 Copy   

    • RRID:Addgene_15409

    This resource has 1+ mentions.

http://www.addgene.org/15409

Species: Homo sapiens
Genetic Insert: MED29
Vector Backbone Description: Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14576168

Proper citation: RRID:Addgene_15409 Copy   

    • RRID:Addgene_154151

    This resource has 1+ mentions.

http://www.addgene.org/154151

Species: Homo sapiens
Genetic Insert: LAMP2 and GCamp6s
Vector Backbone Description: Backbone Size:8300; Vector Backbone:pBoBi; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31204282

Proper citation: RRID:Addgene_154151 Copy   

    • RRID:Addgene_15416

    This resource has 1+ mentions.

http://www.addgene.org/15416

Species: Homo sapiens
Genetic Insert: MED7
Vector Backbone Description: Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12584197

Proper citation: RRID:Addgene_15416 Copy   

    • RRID:Addgene_15424

    This resource has 1+ mentions.

http://www.addgene.org/15424

Species: Homo sapiens
Genetic Insert: MED27
Vector Backbone Description: Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12584197

Proper citation: RRID:Addgene_15424 Copy   

    • RRID:Addgene_15423

    This resource has 1+ mentions.

http://www.addgene.org/15423

Species: Homo sapiens
Genetic Insert: MED22
Vector Backbone Description: Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12584197

Proper citation: RRID:Addgene_15423 Copy   

    • RRID:Addgene_154215

    This resource has 1+ mentions.

http://www.addgene.org/154215

Species: Homo sapiens
Genetic Insert: Sec13
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32719541

Proper citation: RRID:Addgene_154215 Copy   

    • RRID:Addgene_154216

    This resource has 1+ mentions.

http://www.addgene.org/154216

Species: Homo sapiens
Genetic Insert: SEH1L
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32719541

Proper citation: RRID:Addgene_154216 Copy   

http://www.addgene.org/154172

Species: S. sciureus (squirrel monkey)
Genetic Insert: CHMP3
Vector Backbone Description: Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34597582

Proper citation: RRID:Addgene_154172 Copy   

http://www.addgene.org/154173

Species: S. sciureus (squirrel monkey)
Genetic Insert: CHMP3(155)
Vector Backbone Description: Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34597582

Proper citation: RRID:Addgene_154173 Copy   

http://www.addgene.org/154174

Species: S. sciureus (squirrel monkey)
Genetic Insert: retroCHMP3
Vector Backbone Description: Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34597582

Proper citation: RRID:Addgene_154174 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch