Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 222 showing 4421 ~ 4440 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_103053

    This resource has 1+ mentions.

http://www.addgene.org/103053

Species: Zaire ebolavirus, Mayinga
Genetic Insert: VP35
Vector Backbone Description: Vector Backbone:pCAGGs; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27252530

Proper citation: RRID:Addgene_103053 Copy   


  • RRID:Addgene_103063

    This resource has 1+ mentions.

http://www.addgene.org/103063

Species: E. coli
Genetic Insert: Colicin E1 and E1 immunity protein
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19029376
Comments: Insert was cloned from ~base pair 5015 to ~500 of the circular ColE1 plasmid, where numbering begins within the colicin E1 gene. The ColE1 sequences include both the promoter for colicin E1 and for E1 immunity protein, which is transcribed in the opposite direction from the colicin gene. The cloned DNA does not include the intact kil (lysis protein) gene.

Proper citation: RRID:Addgene_103063 Copy   


  • RRID:Addgene_103062

    This resource has 1+ mentions.

http://www.addgene.org/103062

Species: Homo sapiens
Genetic Insert: Cas9 plus expressed GESTALT V1-V5 guide
Vector Backbone Description: Vector Backbone:lentiCRISPR v2; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27229144
Comments: Derived from https://www.addgene.org/52961/

Proper citation: RRID:Addgene_103062 Copy   


http://www.addgene.org/102985

Genetic Insert: TVA-mCherry fusion protein after CRE-mediated recombination
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV, Adeno Associated Viral Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28689641

Proper citation: RRID:Addgene_102985 Copy   


  • RRID:Addgene_103050

    This resource has 1+ mentions.

http://www.addgene.org/103050

Species: (Zaire ebolavirus, Mayinga)
Genetic Insert: VP35 gene of Ebola virus
Vector Backbone Description: Vector Backbone:pCAGGs; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28807685

Proper citation: RRID:Addgene_103050 Copy   


  • RRID:Addgene_102992

    This resource has 1+ mentions.

http://www.addgene.org/102992

Vector Backbone Description: Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29702666

Proper citation: RRID:Addgene_102992 Copy   


  • RRID:Addgene_102964

    This resource has 1+ mentions.

http://www.addgene.org/102964

Species: Homo sapiens
Genetic Insert: shNFS1_2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000229755

Proper citation: RRID:Addgene_102964 Copy   


  • RRID:Addgene_102966

    This resource has 1+ mentions.

http://www.addgene.org/102966

Species: Homo sapiens
Genetic Insert: shNFS1_4
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000180881

Proper citation: RRID:Addgene_102966 Copy   


  • RRID:Addgene_103023

    This resource has 1+ mentions.

http://www.addgene.org/103023

Species: Saccharomyces cerevisiae
Genetic Insert: crPDR12-3.S
Vector Backbone Description: Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617

Proper citation: RRID:Addgene_103023 Copy   


  • RRID:Addgene_103024

    This resource has 1+ mentions.

http://www.addgene.org/103024

Species: Saccharomyces cerevisiae
Genetic Insert: crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
Vector Backbone Description: Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617

Proper citation: RRID:Addgene_103024 Copy   


  • RRID:Addgene_103021

    This resource has 1+ mentions.

http://www.addgene.org/103021

Species: Saccharomyces cerevisiae
Genetic Insert: crHIS4-4.S
Vector Backbone Description: Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617

Proper citation: RRID:Addgene_103021 Copy   


  • RRID:Addgene_103020

    This resource has 1+ mentions.

http://www.addgene.org/103020

Species: Saccharomyces cerevisiae
Genetic Insert: crADE2-3.crHIS4-4.S
Vector Backbone Description: Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29106617

Proper citation: RRID:Addgene_103020 Copy   


  • RRID:Addgene_102976

    This resource has 1+ mentions.

http://www.addgene.org/102976

Species: Homo sapiens
Genetic Insert: shSOD2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000005943

Proper citation: RRID:Addgene_102976 Copy   


  • RRID:Addgene_102972

    This resource has 1+ mentions.

http://www.addgene.org/102972

Species: Homo sapiens
Genetic Insert: shISCU
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000289988

Proper citation: RRID:Addgene_102972 Copy   


  • RRID:Addgene_103192

    This resource has 1+ mentions.

http://www.addgene.org/103192

Species: Homo sapiens
Genetic Insert: hsa-miR-126-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103192 Copy   


  • RRID:Addgene_103130

    This resource has 50+ mentions.

http://www.addgene.org/103130

Species: Other
Genetic Insert: Q73QW6(Cas9 coding gene from Streptococcus mutans serotype c (strain ATCC 700610 / UA159))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103130 Copy   


  • RRID:Addgene_103137

    This resource has 1+ mentions.

http://www.addgene.org/103137

Species: Geminigera cryophila
Genetic Insert: Anion channelrhodopsin GcACR_457
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6217; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28256618

Proper citation: RRID:Addgene_103137 Copy   


  • RRID:Addgene_103219

    This resource has 1+ mentions.

http://www.addgene.org/103219

Species: Homo sapiens
Genetic Insert: hsa-miR-132-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103219 Copy   


  • RRID:Addgene_103369

    This resource has 1+ mentions.

http://www.addgene.org/103369

Species: Homo sapiens
Genetic Insert: hsa-miR-223-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103369 Copy   


  • RRID:Addgene_103550

    This resource has 1+ mentions.

http://www.addgene.org/103550

Species: Homo sapiens
Genetic Insert: hsa-miR-483-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103550 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X