Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGBW-m4134205
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_152527 SARS-CoV-2 N (nucleocapsid) Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009724397.2 Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-08-15 01:07:26 1
pBabe-Puro-RalA-wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15251 v-ral simian leukemia viral oncogene homolog A Homo sapiens Ampicillin PMID:17540176 Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:07:26 1
pMKO.1-Puro-shPP2A-Abeta
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15250 PP2A regulatory subunit A, beta isoform Homo sapiens Ampicillin PMID:17540176 Target sequence: CAACAATTGCCCTAGCACTTG Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:07:25 1
pGBW-m4134010
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_152437 SARS-CoV-2 nsp8 Severe acute respiratory syndrome coronavirus 2 Ampicillin NCBI reference sequence: YP_009725304.1 Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt 2026-08-15 01:07:25 1
pMKO.1-Puro-shPP2A-Aalpha
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15249 PP2A regulatory subunit A, alpha isoform Homo sapiens Ampicillin PMID:17540176 Target sequence: GACAACAGCACCTTGCAGAGT Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:07:25 2
pL0_EF_tPbt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154043 Terminator Pbt P. tricornutum Spectinomycin Vector Backbone:pL0RlacZ; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-15 01:07:45 1
pXL001-TQM IL13 CAR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154054 TQM IL13 CAR Synthetic Ampicillin PMID:32405577 Vector Backbone:pXL001; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:07:45 2
pcDNA3-sACE2v2.4(732)-8h
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154103 Angiotensin-converting enzyme 2 Homo sapiens Ampicillin PMID:32753553 Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint. Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Extracellular, soluble protease domain (a.a. M1-G732) with mutations T27Y, L79T, N330Y 2026-08-15 01:07:46 1
pcDNA3-sACE2v2.4(732)-IgG1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154106 Angiotensin-converting enzyme 2 Homo sapiens Ampicillin PMID:32753553 Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint. Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Extracellular, soluble protease and neck domains (a.a. M1-G732) with mutations T27Y, L79T, N330Y 2026-08-15 01:07:46 4
pcDNA3-sACE2-WT(732)-8h
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154101 Angiotensin-converting enzyme 2 Homo sapiens Ampicillin PMID:32753553 Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint. Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Extracellular, soluble protease and neck domains (a.a. M1-G732) 2026-08-15 01:07:46 3
FLAG-MED29
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15409 MED29 Homo sapiens Ampicillin PMID:14576168 Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N/A 2026-08-15 01:07:45 1
pBoBi-hLAMP2-C-GC6s
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154151 LAMP2 and GCamp6s Homo sapiens Ampicillin PMID:31204282 Backbone Size:8300; Vector Backbone:pBoBi; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin WT 2026-08-15 01:07:46 1
FLAG-MED7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15416 MED7 Homo sapiens Ampicillin PMID:12584197 Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N/A 2026-08-15 01:07:46 1
FLAG-MED27
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15424 MED27 Homo sapiens Ampicillin PMID:12584197 Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N/A 2026-08-15 01:07:47 2
FLAG-MED22
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_15423 MED22 Homo sapiens Ampicillin PMID:12584197 Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N/A 2026-08-15 01:07:47 1
SEC13 in pRK5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154215 Sec13 Homo sapiens Ampicillin PMID:32719541 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:07:47 1
SEH1L in pRK5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154216 SEH1L Homo sapiens Ampicillin PMID:32719541 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:07:47 1
pEF1α-squirrel-monkey-full-length-CHMP3-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154172 CHMP3 S. sciureus (squirrel monkey) Ampicillin PMID:34597582 Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:07:46 1
pEF1α-squirrel-monkey-CHMP3(155)-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154173 CHMP3(155) S. sciureus (squirrel monkey) Ampicillin PMID:34597582 Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C-terminal truncation of CHMP3 at amino acid 155 2026-08-15 01:07:47 1
pEF1α-squirrel-monkey-retroCHMP3-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_154174 retroCHMP3 S. sciureus (squirrel monkey) Ampicillin PMID:34597582 Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:07:47 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch