Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGBW-m4134205 Resource Report Resource Website 1+ mentions |
RRID:Addgene_152527 | SARS-CoV-2 N (nucleocapsid) | Severe acute respiratory syndrome coronavirus 2 | Ampicillin | NCBI reference sequence: YP_009724397.2 | Backbone Size:6080; Vector Backbone:pTwist_CMV_Puro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wt | 2026-08-15 01:07:26 | 1 | |
|
pBabe-Puro-RalA-wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_15251 | v-ral simian leukemia viral oncogene homolog A | Homo sapiens | Ampicillin | PMID:17540176 | Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:26 | 1 | ||
|
pMKO.1-Puro-shPP2A-Abeta Resource Report Resource Website 1+ mentions |
RRID:Addgene_15250 | PP2A regulatory subunit A, beta isoform | Homo sapiens | Ampicillin | PMID:17540176 | Target sequence: CAACAATTGCCCTAGCACTTG | Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:25 | 1 | |
|
pGBW-m4134010 Resource Report Resource Website 1+ mentions |
RRID:Addgene_152437 | SARS-CoV-2 nsp8 | Severe acute respiratory syndrome coronavirus 2 | Ampicillin | NCBI reference sequence: YP_009725304.1 | Backbone Size:6525; Vector Backbone:pTwist_CMV_Hygro_6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wt | 2026-08-15 01:07:25 | 1 | |
|
pMKO.1-Puro-shPP2A-Aalpha Resource Report Resource Website 1+ mentions |
RRID:Addgene_15249 | PP2A regulatory subunit A, alpha isoform | Homo sapiens | Ampicillin | PMID:17540176 | Target sequence: GACAACAGCACCTTGCAGAGT | Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:25 | 2 | |
|
pL0_EF_tPbt Resource Report Resource Website 1+ mentions |
RRID:Addgene_154043 | Terminator Pbt | P. tricornutum | Spectinomycin | Vector Backbone:pL0RlacZ; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-15 01:07:45 | 1 | |||
|
pXL001-TQM IL13 CAR Resource Report Resource Website 1+ mentions |
RRID:Addgene_154054 | TQM IL13 CAR | Synthetic | Ampicillin | PMID:32405577 | Vector Backbone:pXL001; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:45 | 2 | ||
|
pcDNA3-sACE2v2.4(732)-8h Resource Report Resource Website 1+ mentions |
RRID:Addgene_154103 | Angiotensin-converting enzyme 2 | Homo sapiens | Ampicillin | PMID:32753553 | Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint. | Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Extracellular, soluble protease domain (a.a. M1-G732) with mutations T27Y, L79T, N330Y | 2026-08-15 01:07:46 | 1 |
|
pcDNA3-sACE2v2.4(732)-IgG1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_154106 | Angiotensin-converting enzyme 2 | Homo sapiens | Ampicillin | PMID:32753553 | Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint. | Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Extracellular, soluble protease and neck domains (a.a. M1-G732) with mutations T27Y, L79T, N330Y | 2026-08-15 01:07:46 | 4 |
|
pcDNA3-sACE2-WT(732)-8h Resource Report Resource Website 1+ mentions |
RRID:Addgene_154101 | Angiotensin-converting enzyme 2 | Homo sapiens | Ampicillin | PMID:32753553 | Please visit https://www.biorxiv.org/content/10.1101/2020.03.16.994236v1 for BioRxiv preprint. | Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Extracellular, soluble protease and neck domains (a.a. M1-G732) | 2026-08-15 01:07:46 | 3 |
|
FLAG-MED29 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15409 | MED29 | Homo sapiens | Ampicillin | PMID:14576168 | Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:07:45 | 1 | |
|
pBoBi-hLAMP2-C-GC6s Resource Report Resource Website 1+ mentions |
RRID:Addgene_154151 | LAMP2 and GCamp6s | Homo sapiens | Ampicillin | PMID:31204282 | Backbone Size:8300; Vector Backbone:pBoBi; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | WT | 2026-08-15 01:07:46 | 1 | |
|
FLAG-MED7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15416 | MED7 | Homo sapiens | Ampicillin | PMID:12584197 | Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:07:46 | 1 | |
|
FLAG-MED27 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15424 | MED27 | Homo sapiens | Ampicillin | PMID:12584197 | Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:07:47 | 2 | |
|
FLAG-MED22 Resource Report Resource Website 1+ mentions |
RRID:Addgene_15423 | MED22 | Homo sapiens | Ampicillin | PMID:12584197 | Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:07:47 | 1 | |
|
SEC13 in pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_154215 | Sec13 | Homo sapiens | Ampicillin | PMID:32719541 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:47 | 1 | ||
|
SEH1L in pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_154216 | SEH1L | Homo sapiens | Ampicillin | PMID:32719541 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:47 | 1 | ||
|
pEF1α-squirrel-monkey-full-length-CHMP3-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_154172 | CHMP3 | S. sciureus (squirrel monkey) | Ampicillin | PMID:34597582 | Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:46 | 1 | ||
|
pEF1α-squirrel-monkey-CHMP3(155)-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_154173 | CHMP3(155) | S. sciureus (squirrel monkey) | Ampicillin | PMID:34597582 | Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C-terminal truncation of CHMP3 at amino acid 155 | 2026-08-15 01:07:47 | 1 | |
|
pEF1α-squirrel-monkey-retroCHMP3-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_154174 | retroCHMP3 | S. sciureus (squirrel monkey) | Ampicillin | PMID:34597582 | Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:47 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.