Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: human codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP
Vector Backbone Description: Vector Backbone:JDS246 (Plasmid #43861); Vector Types:Mammalian Expression, in vitro transcription; T7 promoter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160140 Copy
Species: Mus musculus
Genetic Insert: Sun1-GFP
Vector Backbone Description: Backbone Marker:Bernardo Sabatini Lab; Backbone Size:5662; Vector Backbone:pAAV-Ef1a-DIO-EGFP-WPRE-pA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33188066
Proper citation: RRID:Addgene_160141 Copy
Species: Homo sapiens
Genetic Insert: FLIP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15367674
Comments: A 1,460-bp sequence containing the promoter region of the FLIP gene was amplified using the BAC clone RP11-536118 (Children’s Hospital Oakland Research Institute, Oakland, Calif.) and inserted into the luciferase-expressing reporter plasmid pGL3-basic (Promega). The sequence corresponds to positions –1179 to +281 relative to the proposed transcriptional start site of CFLAR (FLIP) exon 1 (accession no. AB038965).
Proper citation: RRID:Addgene_16016 Copy
Species: Homo sapiens
Genetic Insert: CARP2
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15069192
Proper citation: RRID:Addgene_16013 Copy
Species: Homo sapiens
Genetic Insert: KILLER/DR5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5600; Vector Backbone:pGL2-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10777207
Comments: A 3.6 Kb Pst1 fragment from the KILLER/DR5 P1 clone which includes 1.6 Kb upstream of the ATG through Intron 2 in KILLER/DR5 genomic DNA.
Proper citation: RRID:Addgene_16012 Copy
Species: Homo sapiens
Genetic Insert: cmyc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15367674
Comments: Contains cmyc with Kozak.
Proper citation: RRID:Addgene_16011 Copy
Species: Mus musculus
Genetic Insert: Ifih1
Vector Backbone Description: Vector Backbone:pLenti6.2 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160110 Copy
Species: Mus musculus
Genetic Insert: Fbxw7 alpha R505C
Vector Backbone Description: Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160104 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160095 Copy
Vector Backbone Description: Backbone Size:10615; Vector Backbone:LentiGuide backbone; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160090 Copy
Vector Backbone Description: Backbone Size:9363; Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160092 Copy
Species: Homo sapiens
Genetic Insert: PAK5
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12897128
Comments: Order of elements: SalI-Myc-XbaI-Pak5-EcoRI
Proper citation: RRID:Addgene_16020 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160136 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160137 Copy
Species: wheat
Genetic Insert: wheat GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875
Proper citation: RRID:Addgene_160392 Copy
Species: SARS-CoV-2
Genetic Insert: 3CL Protease
Vector Backbone Description: Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33910954
Comments: This plasmid is stored and distributed in NEB Stable. It can also be used to transform NEB 10Beta.
The authors have noticed that there are high rates of recombination in these generated vectors. All users are advised to sequence the vectors and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred it is typically between the viral LTR elements in the vector although recombination between the gateway cloning sites has also been observed.
Please visit https://doi.org/10.1101/2020.08.29.272864 for bioRxiv preprint.
Proper citation: RRID:Addgene_160278 Copy
Species: Homo sapiens
Genetic Insert: methyltransferase like 3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30038300
Proper citation: RRID:Addgene_160250 Copy
Species: Synthetic
Genetic Insert: FRB-greenNFAST
Vector Backbone Description: Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32778846
Proper citation: RRID:Addgene_160361 Copy
Species: Homo sapiens
Genetic Insert: beta4
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15988021
Proper citation: RRID:Addgene_16038 Copy
Species: Homo sapiens
Genetic Insert: alpha6
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11044453
Comments: Addgene's sequencing results indicate that this plasmid contains alpha-6 integrin isoform b.
Proper citation: RRID:Addgene_16036 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
