Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCMU-TGN41r Resource Report Resource Website |
RRID:Addgene_61176 | MtSYP41 | Spectinomycin | PMID:25329881 | Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:39 | 0 | |||
|
Actinin-C-stFRET Resource Report Resource Website |
RRID:Addgene_61104 | α-actinin-stFRET | Kanamycin | PMID:18479457 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP–C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:39 | 0 | |||
|
eGFPbait-E2A-KalTA4-pA donor vector Resource Report Resource Website 1+ mentions |
RRID:Addgene_61069 | eGFPbait | Synthetic | Ampicillin and Kanamycin | PMID:24179142 | The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI. | Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:17:39 | 1 | |
|
pSIN4-EF1a-LMO2-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_61064 | LMO2 | Homo sapiens | Ampicillin | PMID:25019369 | Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 1 | ||
|
pCMU-LEr Resource Report Resource Website |
RRID:Addgene_61185 | MtRAB5A2 | Spectinomycin | PMID:25329881 | Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:39 | 0 | |||
|
pSIN4-EF1a-GATA2-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_61063 | GATA2 | Homo sapiens | Ampicillin | PMID:25019369 | Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:39 | 2 | ||
|
pSIN4-EF1a-ETV2-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_61061 | ETV2 | Homo sapiens | Ampicillin | PMID:25019369 | Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 6 | ||
|
pCMU-APr Resource Report Resource Website |
RRID:Addgene_61182 | MtBCPsp-mCherry | Spectinomycin | PMID:25329881 | Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:39 | 0 | |||
|
pSIN4-EF1a-TAL1-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_61065 | TAL1 | Homo sapiens | Ampicillin | PMID:25019369 | Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 1 | ||
|
Spectrin-C-cpstFRET Resource Report Resource Website |
RRID:Addgene_61111 | spectrin-cpstFRET | Kanamycin | PMID:22389408 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:39 | 0 | |||
|
Dm_msi_T Resource Report Resource Website |
RRID:Addgene_61110 | musashi RNA binding domain | Drosophila melanogaster | Ampicillin | Backbone Marker:Novagen; Backbone Size:5456; Vector Backbone:pET22; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:39 | 0 | |||
|
pCDNA3-V5-PTPN14-PPxY Resource Report Resource Website 1+ mentions |
RRID:Addgene_61006 | PTPN14 PPxY mutation | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | PPxY mutation | 2026-08-15 01:17:38 | 1 | |
|
pCDNA3-V5-PTPN14-del-C Resource Report Resource Website 1+ mentions |
RRID:Addgene_61005 | PTPN14 delete C | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 934-1187 | 2026-08-15 01:17:38 | 2 | |
|
pCDNA3-V5-PTPN14-del-N Resource Report Resource Website 1+ mentions |
RRID:Addgene_61004 | PTPN14 delete N | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 17-310 | 2026-08-15 01:17:38 | 2 | |
|
pCDNA3-V5-PTPN14-wild type Resource Report Resource Website 1+ mentions |
RRID:Addgene_61003 | PTPN14 | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 2 | ||
|
UbcH5A Resource Report Resource Website 1+ mentions |
RRID:Addgene_61081 | UbcH5A | Homo sapiens | Ampicillin | PMID:23955022 | Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:39 | 2 | ||
|
gRNA-hIRF-1 #12/pSIR Resource Report Resource Website |
RRID:Addgene_61080 | gRNA_hIRF1 promoter #12 | Homo sapiens | Ampicillin | PMID:25051498 | gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG | Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
pDest27-mBIN1 Resource Report Resource Website |
RRID:Addgene_61086 | smallest constitutive BIN1excluding exon 7, 11, 13-17 | Mus musculus | Ampicillin | PMID:24836577 | Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | ||
|
pAMB_CAT-FspI Resource Report Resource Website |
RRID:Addgene_61002 | Chloramphenicol acetyltransferase | Other | Ampicillin | PMID:26781350 | Backbone Marker:Ambion; Vector Backbone:pAMB; Vector Types:Unspecified; Bacterial Resistance:Ampicillin | FspI site introduced after T7 terminator | 2026-08-15 01:17:38 | 0 | |
|
pUC-H1-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_61089 | H1 promoter; gRNA sequences | Homo sapiens | Ampicillin | PMID:25209046 | As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. | Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.