Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCMU-TGN41r
 
Resource Report
Resource Website
RRID:Addgene_61176 MtSYP41 Spectinomycin PMID:25329881 Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:17:39 0
Actinin-C-stFRET
 
Resource Report
Resource Website
RRID:Addgene_61104 α-actinin-stFRET Kanamycin PMID:18479457 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP–C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:39 0
eGFPbait-E2A-KalTA4-pA donor vector
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61069 eGFPbait Synthetic Ampicillin and Kanamycin PMID:24179142 The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI. Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:17:39 1
pSIN4-EF1a-LMO2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61064 LMO2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 1
pCMU-LEr
 
Resource Report
Resource Website
RRID:Addgene_61185 MtRAB5A2 Spectinomycin PMID:25329881 Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:17:39 0
pSIN4-EF1a-GATA2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61063 GATA2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:39 2
pSIN4-EF1a-ETV2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61061 ETV2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 6
pCMU-APr
 
Resource Report
Resource Website
RRID:Addgene_61182 MtBCPsp-mCherry Spectinomycin PMID:25329881 Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:17:39 0
pSIN4-EF1a-TAL1-IRES-Puro
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61065 TAL1 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 1
Spectrin-C-cpstFRET
 
Resource Report
Resource Website
RRID:Addgene_61111 spectrin-cpstFRET Kanamycin PMID:22389408 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:39 0
Dm_msi_T
 
Resource Report
Resource Website
RRID:Addgene_61110 musashi RNA binding domain Drosophila melanogaster Ampicillin Backbone Marker:Novagen; Backbone Size:5456; Vector Backbone:pET22; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:39 0
pCDNA3-V5-PTPN14-PPxY
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61006 PTPN14 PPxY mutation Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin PPxY mutation 2026-08-15 01:17:38 1
pCDNA3-V5-PTPN14-del-C
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61005 PTPN14 delete C Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 934-1187 2026-08-15 01:17:38 2
pCDNA3-V5-PTPN14-del-N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61004 PTPN14 delete N Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 17-310 2026-08-15 01:17:38 2
pCDNA3-V5-PTPN14-wild type
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61003 PTPN14 Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 2
UbcH5A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61081 UbcH5A Homo sapiens Ampicillin PMID:23955022 Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:39 2
gRNA-hIRF-1 #12/pSIR
 
Resource Report
Resource Website
RRID:Addgene_61080 gRNA_hIRF1 promoter #12 Homo sapiens Ampicillin PMID:25051498 gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 0
pDest27-mBIN1
 
Resource Report
Resource Website
RRID:Addgene_61086 smallest constitutive BIN1excluding exon 7, 11, 13-17 Mus musculus Ampicillin PMID:24836577 Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 0
pAMB_CAT-FspI
 
Resource Report
Resource Website
RRID:Addgene_61002 Chloramphenicol acetyltransferase Other Ampicillin PMID:26781350 Backbone Marker:Ambion; Vector Backbone:pAMB; Vector Types:Unspecified; Bacterial Resistance:Ampicillin FspI site introduced after T7 terminator 2026-08-15 01:17:38 0
pUC-H1-gRNA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61089 H1 promoter; gRNA sequences Homo sapiens Ampicillin PMID:25209046 As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.