Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pGEX Grap-SH2
 
Resource Report
Resource Website
RRID:Addgene_46434 Grap Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.1 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 51-160 2026-08-15 01:15:31 0
pGEX RASGAP(N)-SH2
 
Resource Report
Resource Website
RRID:Addgene_46432 Gap/RASGAP(N) Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.7 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 168-283 2026-08-15 01:15:32 0
pGEX Grb10-PIR-SH2
 
Resource Report
Resource Website
RRID:Addgene_46436 Grb10 Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 45.8 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 355-548 2026-08-15 01:15:31 0
pENTR FL CPAP RNAi resistant
 
Resource Report
Resource Website
RRID:Addgene_46390 CPAP RNAi resistant mutant Homo sapiens Kanamycin PMID:22100914 Backbone Marker:Invitrogen; Backbone Size:2717; Vector Backbone:pENTR 1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin silent mutation that renders it resistant to siRNA :nucleotides 2862–2880, new sequence: 5′-AGAGTTAGCTAGGATCGAAGA-3′ 2026-08-15 01:15:31 0
pBAD-LacI
 
Resource Report
Resource Website
RRID:Addgene_46394 LacI Escherichia coli Ampicillin PMID:23834731 LacI expression was induced with 0.2% (w/v) L-arabinose and cells incubated for 4 h at 20 °C. Backbone Marker:Invitrogen; Backbone Size:4092; Vector Backbone:pBADmyc-hisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin silent T to C mutation at position 19 2026-08-15 01:15:31 0
pAC4 Frk-SH2
 
Resource Report
Resource Website
RRID:Addgene_46428 Frk Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 37.1 kDa Backbone Marker:Avidity; Backbone Size:4216; Vector Backbone:pAC4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 108-213 2026-08-15 01:15:31 0
pGEX FynA-SH2
 
Resource Report
Resource Website
RRID:Addgene_46429 FynA Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 37.4 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 142-251 2026-08-15 01:15:32 0
pArcCreER
 
Resource Report
Resource Website
RRID:Addgene_46389 Arc Mus musculus Ampicillin PMID:23764283 Vector Backbone:pBluescript; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 0
pGEX Eat2-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46423 Eat2 Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 39.6 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 1-132 2026-08-15 01:15:32 1
pGEX Cten-SH2
 
Resource Report
Resource Website
RRID:Addgene_46421 Cten Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 39.1 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 444-570 2026-08-15 01:15:31 0
pGEX Fgr-SH2
 
Resource Report
Resource Website
RRID:Addgene_46427 Fgr Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 37.3 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 137-245 2026-08-15 01:15:31 0
pGEX Emt-SH2
 
Resource Report
Resource Website
RRID:Addgene_46424 Emt Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.8 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 223-346 2026-08-15 01:15:31 0
pcDNA3.1 EWS-myc-HIS
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46386 EWSR1 Homo sapiens Ampicillin PMID:18320585 EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3 5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pGEX-6p-2-EWSR1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46384 EWSR1 Homo sapiens Ampicillin PMID:16044463 The EWS cDNA23 was PCR-amplified using primers ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG. Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:31 1
pGEX Crk-SH2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46418 Crk Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 38.9 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 1-124 2026-08-15 01:15:31 2
pSEDuet40
 
Resource Report
Resource Website
RRID:Addgene_46378 TvoVMA intein Thermoplasma volcanium Kanamycin PMID:22001202 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:31 0
pJDJRSF05
 
Resource Report
Resource Website
RRID:Addgene_46379 NpuDnaE intein inactive Nostoc punctiforme Kanamycin PMID:19636943 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin C1A 2026-08-15 01:15:31 0
pALBRSF12
 
Resource Report
Resource Website
RRID:Addgene_46376 NpuDnaE intein, inactive Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin C1A, C+1A 2026-08-15 01:15:31 0
pHYRSF236
 
Resource Report
Resource Website
RRID:Addgene_46377 NpuDnaE intein delta variant, inactive Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin C1A, C+1A, deleted T76, V97, D98, L100 from NpuDnaE intein 2026-08-15 01:15:31 0
pGEX chimerin-SH2
 
Resource Report
Resource Website
RRID:Addgene_46415 chimerin Homo sapiens Ampicillin PMID:17588523 The molecular weight of the GST fusion protein is approximately 36.8 kDa Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin contains amino acids 44-147 2026-08-15 01:15:31 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.