Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: antiCD19-Notch3-GL4VP64
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32002793
Proper citation: RRID:Addgene_169916 Copy
Species: Mus musculus
Genetic Insert: Grin1
Vector Backbone Description: Vector Backbone:gRNA backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760
Proper citation: RRID:Addgene_169789 Copy
Species: Xenopus laevis
Genetic Insert: Xwnt-5A
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8275867
Comments: Insert: cDNA from Melton lambda gt10 oocyte library.
Transcription: linearize with Xba1 and transcribe with SP6.
Plasmid History:
Constructed by Randall Moon on date of 9/15/90.
Notes for Use:
EcoR1 insert of lambda G6 of 2/11/90. Contains significant 5' UTR and is less translatable in vitro per ng RNA than Xwnt-5A Hind III/SP64T. However, the type of activity is the same in both constructs.
Citation: Moon et al., Development 119, 97 (1993)
Proper citation: RRID:Addgene_16985 Copy
Species: Xenopus laevis
Genetic Insert: banded hedgehog
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Xenopus Hedgehog. Antisense are generated as listed:
Xenopus banded hedgehog: Linearize clone XIL in Bluescript KS with BamH1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert.
Xenopus sonic hedgehog: Linearize clone X32 in Bluescript KS with Bam H1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert.
Xenopus cephalic hedgehog:Linearize clone X30 in pT7TS with Sal 1 and transcribe with T7.
Proper citation: RRID:Addgene_16984 Copy
Vector Backbone Description: Backbone Size:4663; Vector Backbone:pEPIC1.1; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32917762
Proper citation: RRID:Addgene_169897 Copy
Vector Backbone Description: Backbone Size:2427; Vector Backbone:pPID2; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32917762
Proper citation: RRID:Addgene_169898 Copy
Species: Homo sapiens
Genetic Insert: UDP-N-acetylhexosamine pyrophosphorylase
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34288588
Comments: This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point.
Proper citation: RRID:Addgene_169891 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: CCACTACCCCAACCTGGCGG
Proper citation: RRID:Addgene_169892 Copy
Species: Homo sapiens
Genetic Insert: Vangl2/Strabismus
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
Comments: This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations).
Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert.
Proper citation: RRID:Addgene_16992 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: AATGCACCAAATCCTGGAGG
Proper citation: RRID:Addgene_169894 Copy
Species: Homo sapiens
Genetic Insert: TFRC
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pMXS-IRES-BLAST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Proper citation: RRID:Addgene_169890 Copy
Species: Homo sapiens
Genetic Insert: tCD19
Vector Backbone Description: Vector Backbone:PX458; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33903218
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.01.22.427783v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_169817 Copy
Species: Mus musculus
Genetic Insert: pegCTNNB1 S45DEL
Vector Backbone Description: Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33837189
Comments: Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.
Proper citation: RRID:Addgene_169844 Copy
Species: Mus musculus
Genetic Insert: sgCTNNB1 Nicking
Vector Backbone Description: Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33837189
Comments: Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.
Proper citation: RRID:Addgene_169845 Copy
Species: Homo sapiens
Genetic Insert: sgAAT Nicking
Vector Backbone Description: Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33837189
Comments: Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.
Proper citation: RRID:Addgene_169842 Copy
Species: SARS coronavirus 2
Genetic Insert: Protein S
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35046611
Proper citation: RRID:Addgene_169848 Copy
Species: SARS coronavirus 2
Genetic Insert: Protein S
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35046611
Proper citation: RRID:Addgene_169849 Copy
Species: Xenopus laevis
Genetic Insert: Goosecoid
Vector Backbone Description: Backbone Size:3000; Vector Backbone:SP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Insert: coding region of Xenopus goosecoid in SP64T in sense (#9) & antisense (#2) orientation.
Transcription: linearize with EcoR1 and transcribe with SP6.
Plasmid History:
Constructed by Jan Christian by PCR.
Goosecoid cloned and characterized by lab of E. DeRobertis, UCLA.
Proper citation: RRID:Addgene_16979 Copy
Species: Mus musculus
Genetic Insert: safe harbor sgRNA
Vector Backbone Description: Backbone Size:8907; Vector Backbone:pMCB320; Vector Types:Mammalian Expression, Mouse Targeting, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33157015
Proper citation: RRID:Addgene_169834 Copy
Species: Xenopus laevis
Genetic Insert: Xbra
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:psp73; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Insert: full length Xbra from Jim Smith.
Antisense: linearize with EcoRV, transcribe with T7.
Plasmid History:
Constructed by Jan Christian.
Proper citation: RRID:Addgene_16978 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.