Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHR_PGK_antiCD19_Z3_Gal4VP64 Resource Report Resource Website |
RRID:Addgene_169916 | antiCD19-Notch3-GL4VP64 | Danio rerio | Ampicillin | PMID:32002793 | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:03 | 0 | ||
|
Grin1 gRNA#1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_169789 | Grin1 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:gRNA backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 1 | ||
|
XP17 Xwnt-5A Resource Report Resource Website |
RRID:Addgene_16985 | Xwnt-5A | Xenopus laevis | Ampicillin | PMID:8275867 | Insert: cDNA from Melton lambda gt10 oocyte library. Transcription: linearize with Xba1 and transcribe with SP6. Plasmid History: Constructed by Randall Moon on date of 9/15/90. Notes for Use: EcoR1 insert of lambda G6 of 2/11/90. Contains significant 5' UTR and is less translatable in vitro per ng RNA than Xwnt-5A Hind III/SP64T. However, the type of activity is the same in both constructs. Citation: Moon et al., Development 119, 97 (1993) | Backbone Size:3000; Vector Backbone:pSP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
XP6 Banded hh Resource Report Resource Website |
RRID:Addgene_16984 | banded hedgehog | Xenopus laevis | Ampicillin | Xenopus Hedgehog. Antisense are generated as listed: Xenopus banded hedgehog: Linearize clone XIL in Bluescript KS with BamH1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus sonic hedgehog: Linearize clone X32 in Bluescript KS with Bam H1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus cephalic hedgehog:Linearize clone X30 in pT7TS with Sal 1 and transcribe with T7. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | ||
|
pEPIC1.1 Resource Report Resource Website |
RRID:Addgene_169897 | Ampicillin | PMID:32917762 | Backbone Size:4663; Vector Backbone:pEPIC1.1; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | ||||
|
pPID2 Resource Report Resource Website |
RRID:Addgene_169898 | Ampicillin | PMID:32917762 | Backbone Size:2427; Vector Backbone:pPID2; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:03 | 0 | ||||
|
pSin4 UAP1 F383G Resource Report Resource Website 1+ mentions |
RRID:Addgene_169891 | UDP-N-acetylhexosamine pyrophosphorylase | Homo sapiens | Ampicillin | PMID:34288588 | This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point. | Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Changed Phenylalanine (F) at position 383 to glycine (G) | 2026-08-15 01:10:03 | 1 |
|
pLentiCRISPR V2 sgACO1_2 Resource Report Resource Website |
RRID:Addgene_169892 | sgRNA targeting ACO1 | Synthetic | Ampicillin | PMID:34039609 | Target: CCACTACCCCAACCTGGCGG | Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
XE238 hVangl2/Strabismus pCS2P+ Resource Report Resource Website 1+ mentions |
RRID:Addgene_16992 | Vangl2/Strabismus | Homo sapiens | Ampicillin | This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations). Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert. | Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:03 | 1 | ||
|
pLentiCRISPR V2 sgIREB2_1 Resource Report Resource Website |
RRID:Addgene_169894 | sgRNA targeting IREB2 | Synthetic | Ampicillin | PMID:34039609 | Target: AATGCACCAAATCCTGGAGG | Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:03 | 0 | |
|
pMXS-IRES-BLAST TFR1 Resource Report Resource Website |
RRID:Addgene_169890 | TFRC | Homo sapiens | Ampicillin | PMID:34039609 | Backbone Size:5600; Vector Backbone:pMXS-IRES-BLAST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | TFRC cDNA, lacking 3'UTR regulatory elements | 2026-08-15 01:10:02 | 0 | |
|
pDU1 Resource Report Resource Website |
RRID:Addgene_169817 | tCD19 | Homo sapiens | Ampicillin | PMID:33903218 | Please visit https://www.biorxiv.org/content/10.1101/2021.01.22.427783v1 for bioRxiv preprint. | Vector Backbone:PX458; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
pegCTNNB1 S45del Resource Report Resource Website |
RRID:Addgene_169844 | pegCTNNB1 S45DEL | Mus musculus | Ampicillin | PMID:33837189 | Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint. | Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
sgCTNNB1 Nicking Resource Report Resource Website |
RRID:Addgene_169845 | sgCTNNB1 Nicking | Mus musculus | Ampicillin | PMID:33837189 | Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint. | Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
sgAAT Nicking Resource Report Resource Website |
RRID:Addgene_169842 | sgAAT Nicking | Homo sapiens | Ampicillin | PMID:33837189 | Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint. | Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | |
|
pCEP4-myc-S (B.1.1.7 lineage / UK variant) Resource Report Resource Website |
RRID:Addgene_169848 | Protein S | SARS coronavirus 2 | Ampicillin | PMID:35046611 | Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Codon-optimized for human cell expression. | 2026-08-15 01:10:02 | 0 | |
|
pCEP4-myc-S (B.1.351 lineage / South African variant) Resource Report Resource Website |
RRID:Addgene_169849 | Protein S | SARS coronavirus 2 | Ampicillin | PMID:35046611 | Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Codon-optimized for human cell expression. | 2026-08-15 01:10:02 | 0 | |
|
XP11 Goosecoid Resource Report Resource Website |
RRID:Addgene_16979 | Goosecoid | Xenopus laevis | Ampicillin | Insert: coding region of Xenopus goosecoid in SP64T in sense (#9) & antisense (#2) orientation. Transcription: linearize with EcoR1 and transcribe with SP6. Plasmid History: Constructed by Jan Christian by PCR. Goosecoid cloned and characterized by lab of E. DeRobertis, UCLA. | Backbone Size:3000; Vector Backbone:SP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | ||
|
pMCB320-sgNC.SPA Resource Report Resource Website |
RRID:Addgene_169834 | safe harbor sgRNA | Mus musculus | Ampicillin | PMID:33157015 | Backbone Size:8907; Vector Backbone:pMCB320; Vector Types:Mammalian Expression, Mouse Targeting, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 | ||
|
XP12 Xbra Resource Report Resource Website |
RRID:Addgene_16978 | Xbra | Xenopus laevis | Ampicillin | Insert: full length Xbra from Jim Smith. Antisense: linearize with EcoRV, transcribe with T7. Plasmid History: Constructed by Jan Christian. | Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:psp73; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:10:02 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
