Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 226 showing 4501 ~ 4520 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_61197

http://www.addgene.org/61197

Genetic Insert: MAP-MBD
Vector Backbone Description: Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881

Proper citation: RRID:Addgene_61197 Copy   


  • RRID:Addgene_61248

http://www.addgene.org/61248

Species: Synthetic
Genetic Insert: REX-GECO1
Vector Backbone Description: Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP. There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.

Proper citation: RRID:Addgene_61248 Copy   


  • RRID:Addgene_61247

    This resource has 1+ mentions.

http://www.addgene.org/61247

Species: Synthetic
Genetic Insert: REX-GECO0.9
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP.

Proper citation: RRID:Addgene_61247 Copy   


  • RRID:Addgene_61249

http://www.addgene.org/61249

Species: Synthetic
Genetic Insert: REX-GECO0.9
Vector Backbone Description: Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP. There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.

Proper citation: RRID:Addgene_61249 Copy   


  • RRID:Addgene_61244

    This resource has 10+ mentions.

http://www.addgene.org/61244

Species: Synthetic
Genetic Insert: LAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25164254
Comments: The construct is numbered based on GCaMP.

Proper citation: RRID:Addgene_61244 Copy   


  • RRID:Addgene_61243

http://www.addgene.org/61243

Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61243 Copy   


  • RRID:Addgene_61242

    This resource has 1+ mentions.

http://www.addgene.org/61242

Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806

Proper citation: RRID:Addgene_61242 Copy   


http://www.addgene.org/61257

Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299

Proper citation: RRID:Addgene_61257 Copy   


http://www.addgene.org/61256

Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299

Proper citation: RRID:Addgene_61256 Copy   


  • RRID:Addgene_61250

    This resource has 1+ mentions.

http://www.addgene.org/61250

Species: Synthetic
Genetic Insert: sgRNA(F+E)
Vector Backbone Description: Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25491644
Comments: target sequence: ggatggatgtgtagtcaatt

Proper citation: RRID:Addgene_61250 Copy   


  • RRID:Addgene_61253

    This resource has 1+ mentions.

http://www.addgene.org/61253

Species: Caenorhabditis elegans
Genetic Insert: U6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25491644

Proper citation: RRID:Addgene_61253 Copy   


  • RRID:Addgene_61303

    This resource has 1+ mentions.

http://www.addgene.org/61303

Vector Backbone Description: Backbone Marker:Chris Marx; Backbone Size:6878; Vector Backbone:pCM62; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:25262659

Proper citation: RRID:Addgene_61303 Copy   


  • RRID:Addgene_61307

    This resource has 1+ mentions.

http://www.addgene.org/61307

Species: E.coli
Genetic Insert: E. coli lipoic acid ligase
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25313043

Proper citation: RRID:Addgene_61307 Copy   


http://www.addgene.org/61309

Species: Synthetic
Genetic Insert: GAL4_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61309 Copy   


http://www.addgene.org/61308

Species: Bacillus megaterium
Genetic Insert: Cytochrome P450-BM3 heme domain 9D7
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCWori; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22659321

Proper citation: RRID:Addgene_61308 Copy   


  • RRID:Addgene_61261

http://www.addgene.org/61261

Species: Nematode virus
Genetic Insert: Orsay RNA2
Vector Backbone Description: Backbone Marker:Fire Lab Vector Kit ; Backbone Size:3826; Vector Backbone:pPD49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25078701

Proper citation: RRID:Addgene_61261 Copy   


  • RRID:Addgene_61264

    This resource has 1+ mentions.

http://www.addgene.org/61264

Genetic Insert: Ptac-dTomato
Vector Backbone Description: Vector Backbone:pAWP78; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: dTomato reference: Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037

Proper citation: RRID:Addgene_61264 Copy   


  • RRID:Addgene_61263

    This resource has 1+ mentions.

http://www.addgene.org/61263

Vector Backbone Description: Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA

Proper citation: RRID:Addgene_61263 Copy   


  • RRID:Addgene_61313

    This resource has 1+ mentions.

http://www.addgene.org/61313

Species: Synthetic
Genetic Insert: QF2w
Vector Backbone Description: Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61313 Copy   


http://www.addgene.org/61311

Species: Synthetic
Genetic Insert: LexA_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61311 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X