Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: SLC15A1
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131874 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161040 Copy
Species: Homo sapiens
Genetic Insert: SLC16A9
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131876 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161042 Copy
Species: Homo sapiens
Genetic Insert: DIRC2
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131880 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161046 Copy
Species: Homo sapiens
Genetic Insert: MFSD14B
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131881 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161047 Copy
Species: Homo sapiens
Genetic Insert: MFSD8
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131882 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161048 Copy
Species: Homo sapiens
Genetic Insert: hemoglobin subunit beta
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29859120
Comments: Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI.
Proper citation: RRID:Addgene_160996 Copy
Species: Homo sapiens
Genetic Insert: MFSD14A
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131869 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161035 Copy
Species: Homo sapiens
Genetic Insert: RHAG
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131871 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161037 Copy
Species: Homo sapiens
Genetic Insert: SLC10A7
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131872 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161038 Copy
Species: Homo sapiens
Genetic Insert: SLC12A7
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131873 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161039 Copy
Species: Homo sapiens
Genetic Insert: MFSD9
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131894 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161060 Copy
Species: Homo sapiens
Genetic Insert: RHCG
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131895 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161061 Copy
Species: Homo sapiens
Genetic Insert: SLC12A8
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131885 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161051 Copy
Species: Homo sapiens
Genetic Insert: SLC1A3
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131889 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161055 Copy
Species: Homo sapiens
Genetic Insert: FLVCR1
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131892 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161058 Copy
Species: Homo sapiens
Genetic Insert: SLC11A2
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131884 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161050 Copy
Species: Homo sapiens
Genetic Insert: MPC1L
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131918 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161084 Copy
Species: Homo sapiens
Genetic Insert: SLC12A3
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131920 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161086 Copy
Species: Homo sapiens
Genetic Insert: SLC15A5
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131922 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161088 Copy
Species: Homo sapiens
Genetic Insert: SLC12A6
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131956 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161122 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.