Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 226 showing 4501 ~ 4520 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_161040

    This resource has 1+ mentions.

http://www.addgene.org/161040

Species: Homo sapiens
Genetic Insert: SLC15A1
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131874 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161040 Copy   


  • RRID:Addgene_161042

    This resource has 1+ mentions.

http://www.addgene.org/161042

Species: Homo sapiens
Genetic Insert: SLC16A9
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131876 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161042 Copy   


  • RRID:Addgene_161046

    This resource has 1+ mentions.

http://www.addgene.org/161046

Species: Homo sapiens
Genetic Insert: DIRC2
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131880 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161046 Copy   


  • RRID:Addgene_161047

    This resource has 1+ mentions.

http://www.addgene.org/161047

Species: Homo sapiens
Genetic Insert: MFSD14B
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131881 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161047 Copy   


  • RRID:Addgene_161048

    This resource has 1+ mentions.

http://www.addgene.org/161048

Species: Homo sapiens
Genetic Insert: MFSD8
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131882 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161048 Copy   


  • RRID:Addgene_160996

    This resource has 1+ mentions.

http://www.addgene.org/160996

Species: Homo sapiens
Genetic Insert: hemoglobin subunit beta
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29859120
Comments: Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI.

Proper citation: RRID:Addgene_160996 Copy   


  • RRID:Addgene_161035

    This resource has 1+ mentions.

http://www.addgene.org/161035

Species: Homo sapiens
Genetic Insert: MFSD14A
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131869 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161035 Copy   


  • RRID:Addgene_161037

    This resource has 1+ mentions.

http://www.addgene.org/161037

Species: Homo sapiens
Genetic Insert: RHAG
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131871 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161037 Copy   


  • RRID:Addgene_161038

    This resource has 1+ mentions.

http://www.addgene.org/161038

Species: Homo sapiens
Genetic Insert: SLC10A7
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131872 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161038 Copy   


  • RRID:Addgene_161039

    This resource has 1+ mentions.

http://www.addgene.org/161039

Species: Homo sapiens
Genetic Insert: SLC12A7
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131873 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161039 Copy   


  • RRID:Addgene_161060

    This resource has 1+ mentions.

http://www.addgene.org/161060

Species: Homo sapiens
Genetic Insert: MFSD9
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131894 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161060 Copy   


  • RRID:Addgene_161061

    This resource has 1+ mentions.

http://www.addgene.org/161061

Species: Homo sapiens
Genetic Insert: RHCG
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131895 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161061 Copy   


  • RRID:Addgene_161051

    This resource has 1+ mentions.

http://www.addgene.org/161051

Species: Homo sapiens
Genetic Insert: SLC12A8
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131885 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161051 Copy   


  • RRID:Addgene_161055

    This resource has 1+ mentions.

http://www.addgene.org/161055

Species: Homo sapiens
Genetic Insert: SLC1A3
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131889 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161055 Copy   


  • RRID:Addgene_161058

    This resource has 1+ mentions.

http://www.addgene.org/161058

Species: Homo sapiens
Genetic Insert: FLVCR1
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131892 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161058 Copy   


  • RRID:Addgene_161050

    This resource has 1+ mentions.

http://www.addgene.org/161050

Species: Homo sapiens
Genetic Insert: SLC11A2
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131884 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161050 Copy   


  • RRID:Addgene_161084

    This resource has 1+ mentions.

http://www.addgene.org/161084

Species: Homo sapiens
Genetic Insert: MPC1L
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131918 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161084 Copy   


  • RRID:Addgene_161086

    This resource has 1+ mentions.

http://www.addgene.org/161086

Species: Homo sapiens
Genetic Insert: SLC12A3
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131920 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161086 Copy   


  • RRID:Addgene_161088

    This resource has 1+ mentions.

http://www.addgene.org/161088

Species: Homo sapiens
Genetic Insert: SLC15A5
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131922 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161088 Copy   


  • RRID:Addgene_161122

    This resource has 1+ mentions.

http://www.addgene.org/161122

Species: Homo sapiens
Genetic Insert: SLC12A6
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32265506
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131956 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu

Proper citation: RRID:Addgene_161122 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X