Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCMB-MTUBr
 
Resource Report
Resource Website
RRID:Addgene_61197 MAP-MBD Spectinomycin PMID:25329881 Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:17:40 0
AAV-hSyn-REX-GECO1
 
Resource Report
Resource Website
RRID:Addgene_61248 REX-GECO1 Synthetic Ampicillin PMID:25358432 The construct is numbered based on GCaMP. There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function. Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, S142P, D147V, E148G, P220L, N257I, A302P, M339L, T382S 2026-08-15 01:17:40 0
CMV-REX-GECO0.9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61247 REX-GECO0.9 Synthetic Ampicillin PMID:25358432 The construct is numbered based on GCaMP. Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S 2026-08-15 01:17:40 1
AAV-hSyn-REX-GECO0.9
 
Resource Report
Resource Website
RRID:Addgene_61249 REX-GECO0.9 Synthetic Ampicillin PMID:25358432 The construct is numbered based on GCaMP. There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function. Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S 2026-08-15 01:17:40 0
CMV-ER-LAR-GECO1
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_61244 LAR-GECO1 Synthetic Ampicillin PMID:25164254 The construct is numbered based on GCaMP. Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: V51W/I113V/N356S/D363Y/D381Y/F395A/V411A/L415I 2026-08-15 01:17:40 17
pENTR-TER+-shLKB1-Hu
 
Resource Report
Resource Website
RRID:Addgene_61243 LKB1 Homo sapiens Kanamycin PMID:25042806 Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 0
pLentiX2-PURO-shLKB1-Hu
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61242 LKB1 Homo sapiens Ampicillin PMID:25042806 Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 2
pBS-KS-attB1-2-PT-SA-SD-2-2xTY1-V5
 
Resource Report
Resource Website
RRID:Addgene_61257 2xTY1-V5 Synthetic Ampicillin PMID:25324299 Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 0
pBS-KS-attB1-2-PT-SA-SD-1-2xTY1-V5
 
Resource Report
Resource Website
RRID:Addgene_61256 2xTY1-V5 Synthetic Ampicillin PMID:25324299 Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 0
pJW1219
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61250 sgRNA(F+E) Synthetic Ampicillin PMID:25491644 target sequence: ggatggatgtgtagtcaatt Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 5
pJW1310
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61253 U6 promoter Caenorhabditis elegans Kanamycin PMID:25491644 Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 1
pVHD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61303 Chloramphenicol and Tetracycline PMID:25262659 Backbone Marker:Chris Marx; Backbone Size:6878; Vector Backbone:pCM62; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:17:40 2
pcDNA3-FLAG-LplA(AAG)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61307 E. coli lipoic acid ligase E.coli Ampicillin PMID:25313043 Backbone Size:5190; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin E20A, F147A, H149G 2026-08-15 01:17:40 1
pCaSpeR-act5cB-GAL4QF
 
Resource Report
Resource Website
RRID:Addgene_61309 GAL4_DBD::QF2w_AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Changed EK on C-terminus of QF2 to KKKK 2026-08-15 01:17:40 0
pCWori cytochrome P450-BM3h 9D7
 
Resource Report
Resource Website
RRID:Addgene_61308 Cytochrome P450-BM3 heme domain 9D7 Bacillus megaterium Ampicillin PMID:22659321 Backbone Size:5000; Vector Backbone:pCWori; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin T268A, I263A, T438V, A328G 2026-08-15 01:17:41 0
pHIP_RNA2FLAG
 
Resource Report
Resource Website
RRID:Addgene_61261 Orsay RNA2 Nematode virus Ampicillin PMID:25078701 Backbone Marker:Fire Lab Vector Kit ; Backbone Size:3826; Vector Backbone:pPD49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 0
pAWP89
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61264 Ptac-dTomato Kanamycin PMID:25548049 dTomato reference: Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037 Vector Backbone:pAWP78; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 2
pAWP78
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61263 Kanamycin PMID:25548049 In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 2
pQF2wWB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61313 QF2w Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 2
pCaSpeR-act5cB-LexAQFw
 
Resource Report
Resource Website
RRID:Addgene_61311 LexA_DBD::QF2w_AD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Changed EK on C-terminus of QF2 to KKKK 2026-08-15 01:17:41 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.