Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: CG14441
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39731 Copy
Species: Drosophila melanogaster
Genetic Insert: CG14513
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39726 Copy
Species: Drosophila melanogaster
Genetic Insert: CG12075
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39727 Copy
Species: Drosophila melanogaster
Genetic Insert: CG6312
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39722 Copy
Species: Drosophila melanogaster
Genetic Insert: CG6883
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39723 Copy
Species: Drosophila melanogaster
Genetic Insert: CG1864
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39729 Copy
Species: Drosophila melanogaster
Genetic Insert: CG5034
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39717 Copy
Species: Drosophila melanogaster
Genetic Insert: CG6172
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39711 Copy
Species: Drosophila melanogaster
Genetic Insert: CG13617
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39712 Copy
Species: Drosophila melanogaster
Genetic Insert: Torso
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-7Zf; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9892666
Comments: Perrimon Lab plasmid #215
Proper citation: RRID:Addgene_39797 Copy
Species: Drosophila melanogaster
Genetic Insert: CG18023
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39719 Copy
Species: Drosophila melanogaster
Genetic Insert: CG8643
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39718 Copy
Species: Drosophila melanogaster
Genetic Insert: CG6794
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39704 Copy
Species: Drosophila melanogaster
Genetic Insert: CG10571
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).
Proper citation: RRID:Addgene_39709 Copy
Species: Drosophila melanogaster
Genetic Insert: Torso genomic DNA fragment
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2464; Vector Backbone:pSP73; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9892666
Comments: Perrimon Lab plasmid #228
Proper citation: RRID:Addgene_39810 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm14-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm14-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATAGTCCGTACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTACGGACTAT
Proper citation: RRID:Addgene_40851 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm15-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm15-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATAACCCGAACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTTCGGGTTAT
Proper citation: RRID:Addgene_40850 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–mm1-8
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGAACTATACAACCTAGATGGAGTT
as: CTAGAACTCCATCTAGGTTGTATAGTT
Proper citation: RRID:Addgene_40847 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–bulge9-15
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGAACTATAGTTGGATCTACCTCAT
as: CTAGATGAGGTAGATCCAACTATAGTT
Proper citation: RRID:Addgene_40846 Copy
Species: Drosophila melanogaster
Genetic Insert: let-7–bulge 9-13
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge 9-13 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGAACTATACATGGATCTACCTCAT
as: CTAGATGAGGTAGATCCATGTATAGTT
Proper citation: RRID:Addgene_40845 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.