Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:spectinomycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

17,892 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
EcNGRfEfC-R10M3A2
 
Resource Report
Resource Website
RRID:Addgene_48909 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
EcNGRfEfC-R10S1C8
 
Resource Report
Resource Website
RRID:Addgene_48900 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
pZSm45 sodA
 
Resource Report
Resource Website
RRID:Addgene_48890 sodA LuxR Spectinomycin PMID:22178928 Vector Backbone:pZ vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
EcNGRfEfC-R6M1G7
 
Resource Report
Resource Website
RRID:Addgene_48924 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
EcNGRfEfC-R6M1E6
 
Resource Report
Resource Website
RRID:Addgene_48923 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
pZSm45 ndhII
 
Resource Report
Resource Website
RRID:Addgene_48889 ndhII and LuxR Spectinomycin PMID:22178928 Vector Backbone:pZ vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
EcNGRfEfC-R6M1E2
 
Resource Report
Resource Website
RRID:Addgene_48922 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
EcNGRfEfC-R6M1D4
 
Resource Report
Resource Website
RRID:Addgene_48921 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
pAC155-pCR8-sgExpression
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_49045 Spectinomycin PMID:23979020 Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors: http://www.addgene.org/48240/ http://www.addgene.org/48239/ http://www.addgene.org/48238/ http://www.addgene.org/48236/ For more information including protocols and updates, please go to http://www.crispr-on.org Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:56 1
EcNGRfEfC-fadD-tesA'-fadR
 
Resource Report
Resource Website
RRID:Addgene_48939 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG fadE- fadR->CAT, plTet0-> (tesA and fadD), fadR overexpression Vector Backbone:pZE41 backbone (specR), fadD, tesA',fadR; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
EcNGRfEfC-fadD-tesA'
 
Resource Report
Resource Website
RRID:Addgene_48938 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG fadE- fadR->CAT, plTet0-> (tesA and fadD) Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
EcNGRfEfC-R6M3E12
 
Resource Report
Resource Website
RRID:Addgene_48930 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
EcNGRfEfC-R6M3H12
 
Resource Report
Resource Website
RRID:Addgene_48934 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
EcNGRfEfC-R6M3H7
 
Resource Report
Resource Website
RRID:Addgene_48933 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
EcNGRfEfC-R6M3C4
 
Resource Report
Resource Website
RRID:Addgene_48928 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:54 0
EcNGRfEfC-R6M3C3
 
Resource Report
Resource Website
RRID:Addgene_48927 galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Spectinomycin strain contains pZE41 backbone (specR), fadD, tesA' galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:55 0
pAGM1021
 
Resource Report
Resource Website
RRID:Addgene_169084 BvCYP76AD1 Beta vulgaris Spectinomycin PMID:34177999 Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH41308; Vector Types:Synthetic Biology, MoClo Cloning Vector; Bacterial Resistance:Spectinomycin 2026-08-15 01:09:56 0
pAGM49981
 
Resource Report
Resource Website
RRID:Addgene_169087 BvADHα Beta vulgaris Spectinomycin PMID:34177999 Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH41308; Vector Types:Synthetic Biology, MoClo Cloning Vector; Bacterial Resistance:Spectinomycin 2026-08-15 01:09:57 0
pLEVI(408)-ColE-iLight-msfGFP
 
Resource Report
Resource Website
RRID:Addgene_170268 iLight Synthetic Spectinomycin PMID:34162879 Backbone Marker:Y. Yang lab (East China University of Science and Technology, China), https://pubmed.ncbi.nlm.nih.gov/27311594/; Backbone Size:5347; Vector Backbone:pLEVI(408)-ColE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin To design iLight for expression in bacteria, a full-length bacterial phytochrome IsPadC from Idiomarina sp. A28L was used as an original template. First, diguanylyl cyclase effector in IsPadC was removed, then following mutations were introduced: I68F, H80Q, A86T, R90S S242C, E274K, R295H I360V, and L464V. 2026-08-15 01:10:06 0
Prham-M.XbaI-M.EcoRI-M.SalI-p15A-aadA
 
Resource Report
Resource Website
RRID:Addgene_170767 M.XbaI Synthetic Spectinomycin PMID:35255734 Backbone Marker:EMD Millipore/Novagen; Backbone Size:1724; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:10:10 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.