Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,457 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Amphiphysin Type I/Full Length
 
Resource Report
Resource Website 		RRID:Addgene_47390 Amphiphysin Type I Homo sapiens Ampicillin Alanine 65 missing Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
Flag-Rab35 S22N inactive
 
Resource Report
Resource Website 		RRID:Addgene_47429 Rab35 S22N Homo sapiens Ampicillin PMID:23264734 Vector Backbone:pcDNA3-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S22N inactive 2026-08-15 01:15:42 0
GFP-Rab35 WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47424 Rab35 Homo sapiens Kanamycin PMID:23264734 Backbone Marker:clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 8
Flag-Rab35 Q67L active
 
Resource Report
Resource Website 		RRID:Addgene_47428 Rab35 Q67L Homo sapiens Ampicillin PMID:23264734 Vector Backbone:pcDNA3-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Q67L active 2026-08-15 01:15:41 0
GFP-Rab35 S22N inactive
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47426 Rab35 S22N Homo sapiens Kanamycin PMID:23264734 Backbone Marker:clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin S22N inactive 2026-08-15 01:15:41 4
pEN_TT MEK5-DD-mRFP1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47547 MEK5-DD Homo sapiens Gentamicin PMID:23332156 Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin S311D, T315D 2026-08-15 01:15:43 1
Flag-Vac 14 Full Length
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47418 Vac14 Homo sapiens Kanamycin PMID:17161399 Backbone Marker:Agilent; Backbone Size:4324; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:42 3
Intersectin I SH3 A domain (human)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47413 Intersectin SH3 domain A Homo sapiens Ampicillin PMID:9813051 Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin only SH3 domain A 2026-08-15 01:15:41 2
MIGR1-cyclin E-AA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47498 cyclin E1 Homo sapiens Ampicillin PMID:23873023 Human cyclin E1 (CCNE1) cDNA was mutated at N- and C-terminal Cdc4 phosphodegrons (T62A and T380A, see references) to disrupt interaction with Fbw7 ubiquitin ligase. cDNA is inserted into MIGR1 (MSCV-based retroviral vector), permitting transduction of hematopoietic cells. Cloned cDNA contains approximately 100 bp from CCNE1 3' UTR. GFP is co-expressed with cDNA via IRES, permitting enrichment for transduced cells using flow sorting. References: Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW et al (2001). Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase. Science 294: 173-177. Strohmaier H, Spruck CH, Kaiser P, Won KA, Sangfelt O, Reed SI (2001). Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line. Nature 413: 316-322. Backbone Size:6521; Vector Backbone:MIGR1; Vector Types:Mammalian Expression, Retroviral, MSCV-IRES-GFP; Bacterial Resistance:Ampicillin threonines 62 and 380 to alanine (T62A T380A) 2026-08-15 01:15:42 1
Intersectin I SH3 D domain (human)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47416 Intersectin SH3 domain D Homo sapiens Ampicillin PMID:9813051 Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin only SH3 domain D 2026-08-15 01:15:41 1
Intersectin I SH3 E domain (human)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47417 ITSN1 intersectin 1 Homo sapiens Ampicillin PMID:9813051 Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin only SH3 domain E 2026-08-15 01:15:41 1
Intersectin I SH3 B domain (human)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47414 Intersectin SH3 domain B Homo sapiens Ampicillin PMID:9813051 Backbone Size:5000; Vector Backbone:pGEX-4T1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin only SH3 domain B 2026-08-15 01:15:41 1
pVC228 VEGF Site#3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47507 gRNA-VEGF site 3 Homo sapiens Ampicillin PMID:23792628 Target site: GGTGAGTGAGTGTGTGCGTG gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9) Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:42 3
pEGFP GR
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_47504 Glucocorticoid receptor Homo sapiens Kanamycin Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:42 13
pCDNA_B2AR-s-pep
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47438 beta2-adrenergic receptor Homo sapiens Ampicillin PMID:23629648 Notes: (1) The pCDNA/FRT vector contains an extra XbaI site. (2) The XbaI restriction enzyme is sensitive to dam methylation. Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:42 2
pCDNA_B2AR-no-pep
 
Resource Report
Resource Website 		RRID:Addgene_47439 beta2-adrenergic receptor Homo sapiens Ampicillin PMID:23629648 Notes: (1) The pCDNA/FRT vector contains an extra XbaI site. (2) The XbaI restriction enzyme is sensitive to dam methylation. (3) No-pep sensor contains a short repeating GSG sequence at the C-terminus of mCerulean. Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
pCDNA_B2AR-q-pep
 
Resource Report
Resource Website 		RRID:Addgene_47437 beta2-adrenergic receptor Homo sapiens Ampicillin PMID:23629648 Notes: (1) The pCDNA/FRT vector contains an extra XbaI site. (2) The XbaI restriction enzyme is sensitive to dam methylation. Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
Flag Intersectin Short (human)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47392 Intersectin short Homo sapiens Ampicillin PMID:11584276 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 1
Flag-Tagged Clavesin1 (pCMV-Tag2B-Sec14a)
 
Resource Report
Resource Website 		RRID:Addgene_47430 Clavesin1 Homo sapiens Kanamycin PMID:19651769 Backbone Marker:Stratagene; Backbone Size:4324; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 0
GFP-Intersectin Long
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47395 intersectin long Homo sapiens Kanamycin PMID:11584276 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 5

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch