Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 231 showing 4601 ~ 4620 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_12189

http://www.addgene.org/12189

Species: Mus musculus
Genetic Insert: MEKK3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14634666

Proper citation: RRID:Addgene_12189 Copy   


  • RRID:Addgene_121914

http://www.addgene.org/121914

Species: Nostoc punctiforme
Genetic Insert: Oth-NpuDnaBΔ290 intein
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3981; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31665813

Proper citation: RRID:Addgene_121914 Copy   


  • RRID:Addgene_122013

http://www.addgene.org/122013

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6472; Vector Backbone:pETM-NG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki . Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_122013 Copy   


  • RRID:Addgene_122018

    This resource has 1+ mentions.

http://www.addgene.org/122018

Species: Saccharomyces cerevisiae
Genetic Insert: Choline kinase
Vector Backbone Description: Backbone Marker:Silva-Rocha,R., Martinez-Garcia,E., Chavarria,M., Calles,B., Arce-Rodriguez,A., de las Heras,A., Paez-Espino,D.; Backbone Size:3465; Vector Backbone:pSEVA228; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30584096

Proper citation: RRID:Addgene_122018 Copy   


  • RRID:Addgene_122006

http://www.addgene.org/122006

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5917; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki . Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_122006 Copy   


  • RRID:Addgene_122061

http://www.addgene.org/122061

Species: Saccharomyces cerevisiae
Genetic Insert: intergenic terminator from yeast IMD2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5900; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30616008

Proper citation: RRID:Addgene_122061 Copy   


  • RRID:Addgene_122051

http://www.addgene.org/122051

Species: Homo sapiens
Genetic Insert: CYFIP1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24667445

Proper citation: RRID:Addgene_122051 Copy   


  • RRID:Addgene_121999

    This resource has 1+ mentions.

http://www.addgene.org/121999

Genetic Insert: none
Vector Backbone Description: Backbone Size:6073; Vector Backbone:pUC57 and pWH1266; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31548010

Proper citation: RRID:Addgene_121999 Copy   


http://www.addgene.org/121994

Species: Danio rerio
Genetic Insert: mfn2 gRNA
Vector Backbone Description: Backbone Marker:Tol2 kit; Backbone Size:4000; Vector Backbone:p3E; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32788232

Proper citation: RRID:Addgene_121994 Copy   


http://www.addgene.org/121995

Species: Danio rerio
Genetic Insert: opa1 gRNA
Vector Backbone Description: Backbone Marker:Tol2 kit; Backbone Size:4000; Vector Backbone:p3E; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32788232

Proper citation: RRID:Addgene_121995 Copy   


  • RRID:Addgene_122086

    This resource has 1+ mentions.

http://www.addgene.org/122086

Vector Backbone Description: Backbone Marker:Esteban Martínez-García and Víctor de Lorenzo; Backbone Size:3168; Vector Backbone:pEMG; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30861315

Proper citation: RRID:Addgene_122086 Copy   


http://www.addgene.org/122122

Species: Mus musculus
Genetic Insert: Myocardin
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pShuttle; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19342595
Comments: Myocardin contains an A435T difference compared to the Myocd NCBI entry. The functional consequence of this difference is unknown.

Proper citation: RRID:Addgene_122122 Copy   


  • RRID:Addgene_122115

http://www.addgene.org/122115

Species: Homo sapiens
Genetic Insert: Brg1
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19342595

Proper citation: RRID:Addgene_122115 Copy   


  • RRID:Addgene_122117

http://www.addgene.org/122117

Species: Homo sapiens
Genetic Insert: Brg1
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19342595

Proper citation: RRID:Addgene_122117 Copy   


  • RRID:Addgene_122170

    This resource has 1+ mentions.

http://www.addgene.org/122170

Genetic Insert: 10xEGFP
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28669708
Comments: Please note: The MCS of multimeric EGFP vectors differs from the MCS of the monomeric EGFP vector (pEGFP-N1): G CTA GCG CTA CCG GAC TCA GAT CTC GAG CTC AAG CTT GAA ATC GAA TTC CCG CGG GCC CGG GAT CCA CCG GTC GCC ACC ATG GTG

Proper citation: RRID:Addgene_122170 Copy   


  • RRID:Addgene_122172

    This resource has 1+ mentions.

http://www.addgene.org/122172

Genetic Insert: 12xEGFP
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28669708
Comments: Please note: The MCS of multimeric EGFP vectors differs from the MCS of the monomeric EGFP vector (pEGFP-N1): G CTA GCG CTA CCG GAC TCA GAT CTC GAG CTC AAG CTT GAA ATC GAA TTC CCG CGG GCC CGG GAT CCA CCG GTC GCC ACC ATG GTG

Proper citation: RRID:Addgene_122172 Copy   


  • RRID:Addgene_122174

    This resource has 1+ mentions.

http://www.addgene.org/122174

Species: Homo sapiens
Genetic Insert: His6 MBP TEV HDAC8_374
Vector Backbone Description: Backbone Marker:Scott Gradia; Backbone Size:6465; Vector Backbone:pET His6 MBP TEV LIC cloning vector; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28846375

Proper citation: RRID:Addgene_122174 Copy   


  • RRID:Addgene_122173

http://www.addgene.org/122173

Species: Aequorea victoria
Genetic Insert: RS-GFP
Vector Backbone Description: Backbone Marker:prof. Pascal Ratet (French National Centre for Scientific Research); Backbone Size:12400; Vector Backbone:pCP60 (sequence not available in databases) - derivative of pBIN19; Vector Types:Plant Expression, binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19386122

Proper citation: RRID:Addgene_122173 Copy   


  • RRID:Addgene_122162

    This resource has 1+ mentions.

http://www.addgene.org/122162

Genetic Insert: 2xEGFP
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28669708
Comments: Please note: The MCS of multimeric EGFP vectors differs from the MCS of the monomeric EGFP vector (pEGFP-N1): G CTA GCG CTA CCG GAC TCA GAT CTC GAG CTC AAG CTT GAA ATC GAA TTC CCG CGG GCC CGG GAT CCA CCG GTC GCC ACC ATG GTG

Proper citation: RRID:Addgene_122162 Copy   


  • RRID:Addgene_122167

    This resource has 1+ mentions.

http://www.addgene.org/122167

Genetic Insert: 7xEGFP
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28669708
Comments: Please note: The MCS of multimeric EGFP vectors differs from the MCS of the monomeric EGFP vector (pEGFP-N1): G CTA GCG CTA CCG GAC TCA GAT CTC GAG CTC AAG CTT GAA ATC GAA TTC CCG CGG GCC CGG GAT CCA CCG GTC GCC ACC ATG GTG

Proper citation: RRID:Addgene_122167 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X