Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCRII-TOPO CMV-cGFP-bGH Poly(A) Sense
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46835 Coral Green Fluorescent Protein (cGFP) Ampicillin PMID:23073843 Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 1
pCRII-TOPO CMV-cGFP-SV40 Poly(A) Sense
 
Resource Report
Resource Website
RRID:Addgene_46836 Coral Green Fluorescent Protein (cGFP) Ampicillin PMID:23073843 Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pCRII-TOPO CMV-cGFP-mMALAT1_3' Comp.15 Sense
 
Resource Report
Resource Website
RRID:Addgene_46839 Coral Green Fluorescent Protein (cGFP) Ampicillin PMID:23073843 Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
psd44-Lactadherin46
 
Resource Report
Resource Website
RRID:Addgene_46830 MFGE8 Homo sapiens Ampicillin Originally from RSPD, Germany, plasmid IOH46424, in pDEST26 as backbone. Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 0
pMMP-puro-Flag-HA-NR6A1
 
Resource Report
Resource Website
RRID:Addgene_46833 NR6A1 Mus musculus Ampicillin PMID:23630078 Backbone Marker:NA; Backbone Size:7511; Vector Backbone:pMMP-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:15:36 0
pSARSF505
 
Resource Report
Resource Website
RRID:Addgene_46832 GFPN-NpuDnaE_intein-GFP_C Nostoc punctiforme Kanamycin PMID:23974115 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin stemmer GFP with superfolder mutations S30R and Y39N, and SYG->CYG in chromophore 2026-08-15 01:15:35 0
pHAGE PGK-GFP-IRES-LUC-W
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46793 PGK Homo sapiens Ampicillin PMID:20038801 Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 25
pABpuro-BluF
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46824 Bmal1 Mus musculus Ampicillin PMID:16167846 The insert consists of 1 kb of mouse Bmal1 upstream region and 53 nucleotides of exon 1, fused in-frame to the luciferase coding region, and followed by 1 kb of Bmal1 3′UTR. Backbone Marker:Addgene plasmid 12254; Vector Backbone:pWPI; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 17
psd44-G13WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46829 GNA13 Homo sapiens Ampicillin cDNA to make this plasmid was obtained from www.cdna.org (ID GNA1300000). Backbone Marker:Dr. Richard Iggo, University of St Andrews, Edinburgh, UK; Backbone Size:9195; Vector Backbone:psd44; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 2
PCMV-intron myc Rab11 S25N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46786 RAB11A S25N Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab11 S25N FWD (5′-AGCTCGGATCCACCATGGGCACCCGCGACGACGAGT ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAATAATCTCCTGTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S25N dominant negative 2026-08-15 01:15:35 2
Rab8WT(Flag) in pcDNA3.1neo
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46783 RAB8A Homo sapiens Ampicillin PMID:16959776 Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. Backbone Marker:invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 2
pCEV-G1-Ph
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46814 Ampicillin PMID:24161108 Vector Backbone:pSP-G1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 3
pCEV-G4-Km
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46819 Ampicillin PMID:24161108 Vector Backbone:pCEV-G2-Km; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 4
BDD FVIII H4
 
Resource Report
Resource Website
RRID:Addgene_46774 B-domain deleted FVIII H4 (R484H) Homo sapiens Ampicillin Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R484H 2026-08-15 01:15:35 0
FVIII H2
 
Resource Report
Resource Website
RRID:Addgene_46773 full length FVIII D1241E Homo sapiens Ampicillin Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D1241E 2026-08-15 01:15:35 0
PCMV-intron myc Rab1aWT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46776 Rab1a Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 4
PCMV-intron myc Rab1a S25N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46777 Rab1a S25N mutant Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S25N (dominant negative) 2026-08-15 01:15:35 2
pcDNAI-GAL4-CREB-S133A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46770 GAL4(1-147)-CREB-S133A Rattus norvegicus Ampicillin PMID:7958915 Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed CREB serine 133 to Alanine 2026-08-15 01:15:35 1
pcDNAI-GAL4-CREB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46769 GAL4(1-147)-CREB Rattus norvegicus Ampicillin PMID:7958915 Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNAI-AMP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:35 1
pKIKOarsBCm
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46763 Chloramphenicol and Ampicillin PMID:23799955 This plasmid is used for integration of DNA into the E.coli genome via homologous recombination. The DNA of interest is cloned between arsB homologous arms and integrated at the arsB locus. This plasmid has been found exist in our stock as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid. Backbone Size:3267; Vector Backbone:pKD4; Vector Types:E.coli genomic integration; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:35 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.