Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 233 showing 4641 ~ 4660 out of 69,553 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/165470

Species: Homo sapiens
Genetic Insert: Adenosine deaminase RNA specific B2 (inactive)
Vector Backbone Description: Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24778252
Comments: Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site.

Proper citation: RRID:Addgene_165470 Copy   


  • RRID:Addgene_16549

    This resource has 1+ mentions.

http://www.addgene.org/16549

Species: Homo sapiens
Genetic Insert: PPAR gamma
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10555149
Comments: Note that there are some discrepancies between the insert in this plasmid and the canonical GenBank PPARgamma. The Vogelstein lab maintains that this plasmid worked as specified when they made and used it.

Proper citation: RRID:Addgene_16549 Copy   


http://www.addgene.org/165425

Species: Homo sapiens
Genetic Insert: gRNA against PGC-1a variant 1
Vector Backbone Description: Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33626346

Proper citation: RRID:Addgene_165425 Copy   


  • RRID:Addgene_16545

    This resource has 1+ mentions.

http://www.addgene.org/16545

Species: Homo sapiens
Genetic Insert: p73
Vector Backbone Description: Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10588737
Comments: Tet-responsive p73 expression construct.

Proper citation: RRID:Addgene_16545 Copy   


http://www.addgene.org/165426

Species: Homo sapiens
Genetic Insert: gRNA against human Total PGC-1a variants
Vector Backbone Description: Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33626346

Proper citation: RRID:Addgene_165426 Copy   


  • RRID:Addgene_16550

http://www.addgene.org/16550

Species: Homo sapiens
Genetic Insert: PPAR alpha
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10555149

Proper citation: RRID:Addgene_16550 Copy   


  • RRID:Addgene_165494

    This resource has 1+ mentions.

http://www.addgene.org/165494

Species: Homo sapiens
Genetic Insert: Human histone H2B
Vector Backbone Description: Backbone Marker:-; Backbone Size:8023; Vector Backbone:pRRL-cPPT-hPGKTMPrtTA-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29944140
Comments: ABOUT BACKBONE: The lentiviral backbone was originally designed and constructed by Barde I et al. (Barde I et al. Mol Ther. 2006. 13(2): 382-90. PMID: 16275162). ABOUT TEST DIGESTION: Since Xba I restriction site is lost during cloning, we recommend checking the plasmid using the enzymes: Xho I and Nhe I. You should get two fragments around 1600 bp (insert+vector) and 7500 bp (vector).

Proper citation: RRID:Addgene_165494 Copy   


  • RRID:Addgene_165601

http://www.addgene.org/165601

Species: Homo sapiens
Genetic Insert: ribosomal protein S6 kinase A5
Vector Backbone Description: Vector Backbone:LentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33563994

Proper citation: RRID:Addgene_165601 Copy   


  • RRID:Addgene_16561

http://www.addgene.org/16561

Species: Homo sapiens
Genetic Insert: TEM5
Vector Backbone Description: Backbone Marker:Boehringer; Backbone Size:3553; Vector Backbone:pIVEX2.3-MCS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11559528

Proper citation: RRID:Addgene_16561 Copy   


  • RRID:Addgene_16560

http://www.addgene.org/16560

Species: Homo sapiens
Genetic Insert: TEM1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11559528

Proper citation: RRID:Addgene_16560 Copy   


  • RRID:Addgene_16559

    This resource has 10+ mentions.

http://www.addgene.org/16559

Species: Homo sapiens
Genetic Insert: TCF-4 binding sites
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10749138
Comments: TCF-4 mutant binding sequence - CCTTTGGC

Proper citation: RRID:Addgene_16559 Copy   


  • RRID:Addgene_16557

    This resource has 1+ mentions.

http://www.addgene.org/16557

Species: Homo sapiens
Genetic Insert: MADMYC
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10688915
Comments: MADMYC: the amino terminal transactivation domain of c-Myc (aa 1-263) was removed and replaced with the amino terminal transcriptional repression domain (aa 1-38, the Sin3-interaction region) of Mad.

Proper citation: RRID:Addgene_16557 Copy   


  • RRID:Addgene_16554

http://www.addgene.org/16554

Species: Homo sapiens
Genetic Insert: CDX2
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:7462; Vector Backbone:pHRCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10490837
Comments: RKO (colorectal cancer cell line) mutation: 4 base-pair deletion (AGGCAGG to AGG) within the sequence corresponding to helix 3 of the CDX2 homeodomain.

Proper citation: RRID:Addgene_16554 Copy   


  • RRID:Addgene_16553

http://www.addgene.org/16553

Species: Homo sapiens
Genetic Insert: CDX2
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:7462; Vector Backbone:pHRCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10490837

Proper citation: RRID:Addgene_16553 Copy   


  • RRID:Addgene_16552

http://www.addgene.org/16552

Species: Homo sapiens
Genetic Insert: 14-3-3 sigma
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:7462; Vector Backbone:pHRCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9659898

Proper citation: RRID:Addgene_16552 Copy   


  • RRID:Addgene_16585

http://www.addgene.org/16585

Species: Homo sapiens
Genetic Insert: PTTG1
Vector Backbone Description: Backbone Size:3939; Vector Backbone:pFredB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11371342
Comments: 5 kb 3' targeting element, should be linearized with SalI prior to transfection.

Proper citation: RRID:Addgene_16585 Copy   


  • RRID:Addgene_16566

http://www.addgene.org/16566

Species: Homo sapiens
Genetic Insert: c-MYC binding sites
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:4867; Vector Backbone:pBV-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10688915
Comments: Different combinations of oligonucleotide pairs (A+B, A+D, C+B, C+D) were annealed and converted to double-stranded fragments through one PCR cycle. These promoter fragments were subcloned into pBV-luc. Further polymerase-derived mutants were identified while sequencing the reporter constructs.

Proper citation: RRID:Addgene_16566 Copy   


  • RRID:Addgene_16565

    This resource has 1+ mentions.

http://www.addgene.org/16565

Species: Homo sapiens
Genetic Insert: c-MYC binding sites
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:4867; Vector Backbone:pBV-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10688915
Comments: To generate reporter constructs, the following oligonucleotides were used: 5'-CCGGTACCGG GTTGTGGCAG CCAGTCACCT GCCCGCCGCG TAGCCACACC TCTGCTCCTC AGAGCAATGT CAAGCGGTCA CCTGTGATAG CAACAGATCA CCTGGCTGCC ATCGCCCCTC-3' [Oligo C , for mutant MBS1-3]; 5'-ATGAATTCCG GACGTTCTGG GCAGGTGACC GCCACCCATG CGCTGAGGGG CGGACAGGAG GTGCTTCGAC TGGGAGGAGG GCGAAGAGTG TAAGGGGGCG GAGGGGCGAT GGCAGCCAGG-3' [Oligo D, for mutant MBS4]. Different combinations of oligonucleotide pairs (A+B, A+D, C+B, C+D) were annealed and converted to double-stranded fragments through one PCR cycle. These promoter fragments were subcloned into pBV-luc. Further polymerase-derived mutants were identified while sequencing the reporter constructs.

Proper citation: RRID:Addgene_16565 Copy   


  • RRID:Addgene_16564

    This resource has 10+ mentions.

http://www.addgene.org/16564

Species: Homo sapiens
Genetic Insert: c-MYC binding sites
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:4867; Vector Backbone:pBV-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10688915
Comments: To generate reporter constructs, the following oligonucleotides were used: 5'-CCGGTACCGG GTTGTGGCAG CCAGTCACGT GCCCGCCGCG TAGCCACACC TCTGCTCCTC AGAGCAATGT CAAGCGGTCA CGTGTGATAG CAACAGATCA CGTGGCTGCC ATCGCCCCTC-3' [Oligo A, for wild-type c-MYC binding sites (MBS)1-3]; 5'-ATGAATTCCG GACGTTCTGG GCACGTGACC GCCACCCATG CGCTGAGGGG CGGACAGGAG GTGCTTCGAC TGGGAGGAGG GCGAAGAGTG TAAGGGGGCG GAGGGGCGAT GGCAGCC-3' [Oligo B, for wild-type MBS4]. Different combinations of oligonucleotide pairs (A+B, A+D, C+B, C+D) were annealed and converted to double-stranded fragments through one PCR cycle. These promoter fragments were subcloned into pBV-luc. Further polymerase-derived mutants were identified while sequencing the reporter constructs.

Proper citation: RRID:Addgene_16564 Copy   


  • RRID:Addgene_16576

http://www.addgene.org/16576

Species: Homo sapiens
Genetic Insert: cAPC
Vector Backbone Description: Backbone Marker:Vogelstein Lab; Backbone Size:0; Vector Backbone:pShuttle / pAdTrack ?; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10749138
Comments: The cAPC containing amino acids 958-2075 (nucleotides 2890–6240) was isolated from pCMV-APC by BglII digestion. This fragment was subcloned into the pEGFP-C1 (Clontech). The cassette containing the EGFP-tagged cAPC was further subcloned into the shuttle vector (pShuttle) using Apal I and Mlu I sites.

Proper citation: RRID:Addgene_16576 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X