Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Brn4
Vector Backbone Description: Backbone Size:5871; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22445517
Proper citation: RRID:Addgene_47028 Copy
Species: Homo sapiens
Genetic Insert: Bcl2
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23403638
Comments: Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro.
Proper citation: RRID:Addgene_46971 Copy
Species: Mus musculus
Genetic Insert: Mu L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22985477
Proper citation: RRID:Addgene_47023 Copy
Species: Homo sapiens
Genetic Insert: human Ku70
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46961 Copy
Species: Synthetic
Genetic Insert: AtU6p::sgRNA_PDS
Vector Backbone Description: Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23929340
Comments: gRNA target sequence GCCGTTAATTTGAGAGTCCA
Proper citation: RRID:Addgene_46966 Copy
Species: Physarum polycephalum
Genetic Insert: NLS-I-PpoI
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46963 Copy
Species: Synthetic
Genetic Insert: FLAG tag
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46956 Copy
Species: Homo sapiens
Genetic Insert: Ku70
Vector Backbone Description: Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46957 Copy
Species: Homo sapiens
Genetic Insert: HPV52L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18360909
Proper citation: RRID:Addgene_46950 Copy
Vector Backbone Description: Backbone Marker:Dr. Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE-CAGS-W; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21307310
Proper citation: RRID:Addgene_46948 Copy
Species: Homo sapiens
Genetic Insert: Ap1g1-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602
Proper citation: RRID:Addgene_46945 Copy
Species: Aequorea victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18228512
Proper citation: RRID:Addgene_46949 Copy
Species: Homo sapiens
Genetic Insert: Ap2a2-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602
Proper citation: RRID:Addgene_46944 Copy
Genetic Insert: 5' iRFP arm
Vector Backbone Description: Backbone Size:5065; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685
Proper citation: RRID:Addgene_46941 Copy
Species: Homo sapiens
Genetic Insert: Mitotrap
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20159602
Proper citation: RRID:Addgene_46942 Copy
Species: Mus musculus
Genetic Insert: PGC-1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14744933
Comments: Please see Addgene plasmid 1026 (pcDNA-f:PGC1) for wildtype sequence and map.
Proper citation: RRID:Addgene_47 Copy
Species: P. haloplanktis
Genetic Insert: PheS Gly294
Vector Backbone Description: Backbone Marker:Open Biosystems; Backbone Size:11688; Vector Backbone:GIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21307310
Proper citation: RRID:Addgene_46936 Copy
Species: Homo sapiens
Genetic Insert: SH3BP4 W92A
Vector Backbone Description: Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22575674
Comments: Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer:
cacatctggcggtgaggcgtggtacgcacacaac
Proper citation: RRID:Addgene_46893 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46932 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46930 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.