Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCMV3Tag8li-hADARB2-3xFLAG Resource Report Resource Website |
RRID:Addgene_165470 | Adenosine deaminase RNA specific B2 (inactive) | Homo sapiens | Ampicillin | PMID:24778252 | Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site. | Backbone Marker:Stratagene /Agilent; Backbone Size:5200; Vector Backbone:pCMV-3Tag-8 modified MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 0 | |
|
pGST-PPARgamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_16549 | PPAR gamma | Homo sapiens | Ampicillin | PMID:10555149 | Note that there are some discrepancies between the insert in this plasmid and the canonical GenBank PPARgamma. The Vogelstein lab maintains that this plasmid worked as specified when they made and used it. | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | N-terminal DNA-binding domain: aa 1-248 | 2026-08-15 01:09:29 | 2 |
|
pSico_U6-PGC1a1 sgRNA Resource Report Resource Website |
RRID:Addgene_165425 | gRNA against PGC-1a variant 1 | Homo sapiens | Ampicillin | PMID:33626346 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:28 | 0 | ||
|
pBI-p73 wt/EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_16545 | p73 | Homo sapiens | Ampicillin | PMID:10588737 | Tet-responsive p73 expression construct. | Backbone Size:5210; Vector Backbone:pBI-MCS-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:29 | 1 | |
|
pSico_U6-Pan-PGC1a sgRNA Resource Report Resource Website |
RRID:Addgene_165426 | gRNA against human Total PGC-1a variants | Homo sapiens | Ampicillin | PMID:33626346 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:28 | 0 | ||
|
pGST-PPARalpha Resource Report Resource Website |
RRID:Addgene_16550 | PPAR alpha | Homo sapiens | Ampicillin | PMID:10555149 | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | N-terminal DNA-binding domain: aa 1-249 | 2026-08-15 01:09:29 | 0 | |
|
pSIN-TRE-H2BeGFP-rtTA2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_165494 | Human histone H2B | Homo sapiens | Ampicillin | PMID:29944140 | ABOUT BACKBONE: The lentiviral backbone was originally designed and constructed by Barde I et al. (Barde I et al. Mol Ther. 2006. 13(2): 382-90. PMID: 16275162). ABOUT TEST DIGESTION: Since Xba I restriction site is lost during cloning, we recommend checking the plasmid using the enzymes: Xho I and Nhe I. You should get two fragments around 1600 bp (insert+vector) and 7500 bp (vector). | Backbone Marker:-; Backbone Size:8023; Vector Backbone:pRRL-cPPT-hPGKTMPrtTA-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | - | 2026-08-15 01:09:29 | 1 |
|
dCas9-MSK1 Resource Report Resource Website |
RRID:Addgene_165601 | ribosomal protein S6 kinase A5 | Homo sapiens | Ampicillin | PMID:33563994 | Vector Backbone:LentiCRISPR v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 | ||
|
pIVEX2.3 TEM-5 Resource Report Resource Website |
RRID:Addgene_16561 | TEM5 | Homo sapiens | Ampicillin | PMID:11559528 | Backbone Marker:Boehringer; Backbone Size:3553; Vector Backbone:pIVEX2.3-MCS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Extracellular region | 2026-08-15 01:09:31 | 0 | |
|
pGEX TEM-1 Resource Report Resource Website |
RRID:Addgene_16560 | TEM1 | Homo sapiens | Ampicillin | PMID:11559528 | Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Extracellular region | 2026-08-15 01:09:30 | 0 | |
|
pGL3-OF (mutant TCF-4 sites) Resource Report Resource Website 10+ mentions |
RRID:Addgene_16559 | TCF-4 binding sites | Homo sapiens | Ampicillin | PMID:10749138 | TCF-4 mutant binding sequence - CCTTTGGC | Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 3 copies of mutant Tcf-4 binding sites | 2026-08-15 01:09:30 | 11 |
|
MadMyc-HA Resource Report Resource Website 1+ mentions |
RRID:Addgene_16557 | MADMYC | Homo sapiens | Ampicillin | PMID:10688915 | MADMYC: the amino terminal transactivation domain of c-Myc (aa 1-263) was removed and replaced with the amino terminal transcriptional repression domain (aa 1-38, the Sin3-interaction region) of Mad. | Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Dominant negative mutant | 2026-08-15 01:09:30 | 2 |
|
CMV-CDX2-MUT Resource Report Resource Website |
RRID:Addgene_16554 | CDX2 | Homo sapiens | Kanamycin | PMID:10490837 | RKO (colorectal cancer cell line) mutation: 4 base-pair deletion (AGGCAGG to AGG) within the sequence corresponding to helix 3 of the CDX2 homeodomain. | Backbone Marker:Vogelstein Lab; Backbone Size:7462; Vector Backbone:pHRCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | RKO mutation | 2026-08-15 01:09:30 | 0 |
|
CMV-CDX2-WT Resource Report Resource Website |
RRID:Addgene_16553 | CDX2 | Homo sapiens | Kanamycin | PMID:10490837 | Backbone Marker:Vogelstein Lab; Backbone Size:7462; Vector Backbone:pHRCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:30 | 0 | ||
|
pHRCMV 14-3-3 sigma Resource Report Resource Website |
RRID:Addgene_16552 | 14-3-3 sigma | Homo sapiens | Kanamycin | PMID:9659898 | Backbone Marker:Vogelstein Lab; Backbone Size:7462; Vector Backbone:pHRCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:29 | 0 | ||
|
pFredB-PTTG1 Resource Report Resource Website |
RRID:Addgene_16585 | PTTG1 | Homo sapiens | Ampicillin | PMID:11371342 | 5 kb 3' targeting element, should be linearized with SalI prior to transfection. | Backbone Size:3939; Vector Backbone:pFredB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 3' targeting element | 2026-08-15 01:09:32 | 0 |
|
pBV-Luc mut MBS1 Resource Report Resource Website |
RRID:Addgene_16566 | c-MYC binding sites | Homo sapiens | Ampicillin | PMID:10688915 | Different combinations of oligonucleotide pairs (A+B, A+D, C+B, C+D) were annealed and converted to double-stranded fragments through one PCR cycle. These promoter fragments were subcloned into pBV-luc. Further polymerase-derived mutants were identified while sequencing the reporter constructs. | Backbone Marker:Vogelstein Lab; Backbone Size:4867; Vector Backbone:pBV-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Mutant MBS1 | 2026-08-15 01:09:31 | 0 |
|
pBV-Luc mut MBS1-4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_16565 | c-MYC binding sites | Homo sapiens | Ampicillin | PMID:10688915 | To generate reporter constructs, the following oligonucleotides were used: 5'-CCGGTACCGG GTTGTGGCAG CCAGTCACCT GCCCGCCGCG TAGCCACACC TCTGCTCCTC AGAGCAATGT CAAGCGGTCA CCTGTGATAG CAACAGATCA CCTGGCTGCC ATCGCCCCTC-3' [Oligo C , for mutant MBS1-3]; 5'-ATGAATTCCG GACGTTCTGG GCAGGTGACC GCCACCCATG CGCTGAGGGG CGGACAGGAG GTGCTTCGAC TGGGAGGAGG GCGAAGAGTG TAAGGGGGCG GAGGGGCGAT GGCAGCCAGG-3' [Oligo D, for mutant MBS4]. Different combinations of oligonucleotide pairs (A+B, A+D, C+B, C+D) were annealed and converted to double-stranded fragments through one PCR cycle. These promoter fragments were subcloned into pBV-luc. Further polymerase-derived mutants were identified while sequencing the reporter constructs. | Backbone Marker:Vogelstein Lab; Backbone Size:4867; Vector Backbone:pBV-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Mutant MBS1-4 | 2026-08-15 01:09:31 | 4 |
|
pBV-Luc wt MBS1-4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_16564 | c-MYC binding sites | Homo sapiens | Ampicillin | PMID:10688915 | To generate reporter constructs, the following oligonucleotides were used: 5'-CCGGTACCGG GTTGTGGCAG CCAGTCACGT GCCCGCCGCG TAGCCACACC TCTGCTCCTC AGAGCAATGT CAAGCGGTCA CGTGTGATAG CAACAGATCA CGTGGCTGCC ATCGCCCCTC-3' [Oligo A, for wild-type c-MYC binding sites (MBS)1-3]; 5'-ATGAATTCCG GACGTTCTGG GCACGTGACC GCCACCCATG CGCTGAGGGG CGGACAGGAG GTGCTTCGAC TGGGAGGAGG GCGAAGAGTG TAAGGGGGCG GAGGGGCGAT GGCAGCC-3' [Oligo B, for wild-type MBS4]. Different combinations of oligonucleotide pairs (A+B, A+D, C+B, C+D) were annealed and converted to double-stranded fragments through one PCR cycle. These promoter fragments were subcloned into pBV-luc. Further polymerase-derived mutants were identified while sequencing the reporter constructs. | Backbone Marker:Vogelstein Lab; Backbone Size:4867; Vector Backbone:pBV-Luc; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 13 | |
|
Ad-CBR (GFP/cAPC) Resource Report Resource Website |
RRID:Addgene_16576 | cAPC | Homo sapiens | Kanamycin | PMID:10749138 | The cAPC containing amino acids 958-2075 (nucleotides 2890–6240) was isolated from pCMV-APC by BglII digestion. This fragment was subcloned into the pEGFP-C1 (Clontech). The cassette containing the EGFP-tagged cAPC was further subcloned into the shuttle vector (pShuttle) using Apal I and Mlu I sites. | Backbone Marker:Vogelstein Lab; Backbone Size:0; Vector Backbone:pShuttle / pAdTrack ?; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | Residues 958-2076 | 2026-08-15 01:09:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
