Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Anti-BAF53b [N332B/15R-2b]
 
Resource Report
Resource Website 		RRID:Addgene_220430 Anti-BAF53b (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3096477. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:29 0
Anti-GABA-A-R-Alpha4 [N398A/34R-2b]
 
Resource Report
Resource Website 		RRID:Addgene_220432 Anti-GABA-A-R-Alpha4 (Rattus norvegicus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3096479. Isotype: IgG2b. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:29 0
Anti-Calbindin [L109/43R]
 
Resource Report
Resource Website 		RRID:Addgene_222146 Anti-Calbindin (Homo sapiens) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099596. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
Anti-Homer1 [L113/60R]
 
Resource Report
Resource Website 		RRID:Addgene_222147 Anti-Homer1 (Mus musculus) recombinant mouse monoclonal antibody. Mus musculus Ampicillin PMID:37758930 RRID: AB_3099597. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:30:30 0
pLVUT-spGFP
 
Resource Report
Resource Website 		RRID:Addgene_225486 Igκ leader and TAT peptide Mus musculus Ampicillin PMID:27746349 Backbone Marker:Addgene Plasmid #11651, PIs Patrick Aebischer and Didier Trono; Backbone Size:11497; Vector Backbone:pLVUT-tTR-KRAB; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:30:32 0
pPicZ:mTREK-1_cryst_I110D
 
Resource Report
Resource Website 		RRID:Addgene_209640 Potassium channel subfamily K member 2 (KCNK2, TREK-1) I110D mutant Mus musculus Bleocin (Zeocin) PMID:32059793 Vector Backbone:pPicZ; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) aa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A92P, N95S, S96D, T97Q, N119A, S300A, E306A, I110D 2026-08-15 01:30:32 0
pGEMHE:mTREK-1(S131C/A286F)
 
Resource Report
Resource Website 		RRID:Addgene_224748 Potassium channel subfamily K member 2 Mus musculus Ampicillin PMID:39029456 Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin S131C / A286F 2026-08-15 01:30:33 0
RNF149 shRNA-TRE
 
Resource Report
Resource Website 		RRID:Addgene_225337 RNF149 shRNA Mus musculus Ampicillin PMID:36610398 Vector Backbone:pAAV-TRE-miR-E ; Vector Types:Mammalian Expression, AAV, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
mTph2p(330bp)-mut4-Luc
 
Resource Report
Resource Website 		RRID:Addgene_223667 mTph2 promoter Mus musculus Ampicillin PMID:39147805 Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
pGEMHE:mTREK-1 (S131A/C159A/C219A/C365A/C399A)
 
Resource Report
Resource Website 		RRID:Addgene_224756 Potassium channel subfamily K member 2 Mus musculus Ampicillin PMID:39029456 Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin S131A/C159A/C219A/C365A/C399A 2026-08-15 01:30:33 0
pGEMHE:mTREK-1 (C159A/C219A/C365A/C399A)
 
Resource Report
Resource Website 		RRID:Addgene_224754 Potassium channel subfamily K member 2 Mus musculus Ampicillin PMID:39029456 Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin C159A/C219A/C365A/C399A 2026-08-15 01:30:33 0
mTph2p(330bp)-mut3-Luc
 
Resource Report
Resource Website 		RRID:Addgene_223666 mTph2 promoter Mus musculus Ampicillin PMID:39147805 Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
mTph2p(330bp)-Luc
 
Resource Report
Resource Website 		RRID:Addgene_223663 mTph2 promoter Mus musculus Ampicillin PMID:39147805 Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
Luciferase shRNA
 
Resource Report
Resource Website 		RRID:Addgene_225343 Luciferase shRNA Mus musculus Ampicillin PMID:36610398 Vector Backbone:pAAV-CBA-miR-E ; Vector Types:Mammalian Expression, AAV, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
pLVX-puro-mGSDME D270A
 
Resource Report
Resource Website 		RRID:Addgene_223518 GSDME Mus musculus Ampicillin PMID:32188940 Vector Backbone:pLVX-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin D270A 2026-08-15 01:30:33 0
pAAV-U6-sgPet-1-hSyn-mCherry-KASH
 
Resource Report
Resource Website 		RRID:Addgene_223227 Fev Mus musculus Ampicillin PMID:39147805 gRNA target sequence: GCCGCGCCACCTCGTCCGGGTCGG Backbone Size:5270; Vector Backbone:pAAV-U6-sgRNA-hSyn-mCherry-KASH; Vector Types:Mammalian Expression, Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
 
Resource Report
Resource Website 		RRID:Addgene_223226 Nr1d1 Mus musculus Ampicillin PMID:39147805 Backbone Size:5270; Vector Backbone:pAAV-U6-sgRNA-hSyn-mCherry-KASH; Vector Types:Mammalian Expression, Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:30:33 0
pGEMHE:mTREK-1(G171F)
 
Resource Report
Resource Website 		RRID:Addgene_224747 Potassium channel subfamily K member 2 Mus musculus Ampicillin PMID:39029456 Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin G171F 2026-08-15 01:30:37 0
pGEMHE:mTREK-1(S131A)
 
Resource Report
Resource Website 		RRID:Addgene_224745 Potassium channel subfamily K member 2 Mus musculus Ampicillin PMID:39029456 Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin S131A 2026-08-15 01:30:37 0
pGEMHE:mTRAAK(Q233K)
 
Resource Report
Resource Website 		RRID:Addgene_224767 Potassium channel subfamily member 4 Mus musculus Ampicillin PMID:39029456 Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin Q233K 2026-08-15 01:30:37 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch