Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pMX-Brn4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47028 Brn4 Mus musculus Ampicillin PMID:22445517 Backbone Size:5871; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin The insert includes 40 bp of the TOPO vector in the 5 end 2026-08-15 01:15:37 1
pCDH-puro-Bcl2
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46971 Bcl2 Homo sapiens Ampicillin PMID:23403638 Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro. Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 10
pMusheLL
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47023 Mu L1+L2 Mus musculus Ampicillin PMID:22985477 Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
pICE-EGFP-FLAG-Ku70siR-WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46961 human Ku70 Homo sapiens Ampicillin PMID:23897892 Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
pICH86966::AtU6p::sgRNA_PDS
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46966 AtU6p::sgRNA_PDS Synthetic Kanamycin PMID:23929340 gRNA target sequence GCCGTTAATTTGAGAGTCCA Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 25
pICE-HA-NLS-I-PpoI
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46963 NLS-I-PpoI Physarum polycephalum Ampicillin PMID:23897892 Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 3
pEGFP-C1-FLAG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46956 FLAG tag Synthetic Kanamycin PMID:23897892 Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:37 9
pEGFP-C1-FLAG-Ku70
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46957 Ku70 Homo sapiens Kanamycin PMID:23897892 Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:36 13
p52sheLL
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46950 HPV52L1+L2 Homo sapiens Ampicillin PMID:18360909 Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 2
pINDUCER21 (ORF-EG)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46948 Chloramphenicol and Ampicillin PMID:21307310 Backbone Marker:Dr. Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE-CAGS-W; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:15:36 33
pIRES-Ap1g1-FKBP
 
Resource Report
Resource Website
RRID:Addgene_46945 Ap1g1-FKBP Homo sapiens Ampicillin PMID:20159602 Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 0
pCIneoEGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46949 GFP Aequorea victoria Ampicillin PMID:18228512 Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 5
pIRES-Ap2a2-FKBP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46944 Ap2a2-FKBP Homo sapiens Ampicillin PMID:20159602 Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pCVL.SSA TLR (CCR5 TALEN Sce Spacer)
 
Resource Report
Resource Website
RRID:Addgene_46941 5' iRFP arm Ampicillin PMID:24121685 Backbone Size:5065; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin truncated 38 amino acids from C terminus 2026-08-15 01:15:37 0
pEYFP-Mitotrap
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46942 Mitotrap Homo sapiens Kanamycin PMID:20159602 Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:36 4
pcDNA-f:PGC1-3D
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47 PGC-1a Mus musculus Ampicillin PMID:14744933 Please see Addgene plasmid 1026 (pcDNA-f:PGC1) for wildtype sequence and map. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Amino acids 262, 265, and 298 have been changed to aspartic acid 2026-08-15 01:15:37 6
pINDUCER13 (miR-LUP)
 
Resource Report
Resource Website
RRID:Addgene_46936 PheS Gly294 P. haloplanktis Ampicillin PMID:21307310 Backbone Marker:Open Biosystems; Backbone Size:11688; Vector Backbone:GIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pRK5-HA-SH3BP4 W92A
 
Resource Report
Resource Website
RRID:Addgene_46893 SH3BP4 W92A Homo sapiens Ampicillin PMID:22575674 Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin W92A (mutated SH3 domain) 2026-08-15 01:15:36 0
LZRSMS-GFP-hFJX1-Myc
 
Resource Report
Resource Website
RRID:Addgene_46932 FJX1 Homo sapiens Ampicillin Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pcDNA-zeo-hFJX1-myc
 
Resource Report
Resource Website
RRID:Addgene_46930 FJX1 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.