Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: NRP1
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839
Proper citation: RRID:Addgene_158384 Copy
Species: Synthetic
Genetic Insert: dpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
Vector Backbone Description: Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34168320
Comments: Please note: This plasmid is prone to recombination in Agrobacterium. Users are recommended to use plasmid 158414
Proper citation: RRID:Addgene_158408 Copy
Species: Homo sapiens
Genetic Insert: ACE2
Vector Backbone Description: Vector Backbone:pLEX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed.
Proper citation: RRID:Addgene_158449 Copy
Species: Homo sapiens
Genetic Insert: TMPRSS11D
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed.
Proper citation: RRID:Addgene_158447 Copy
Species: Homo sapiens
Genetic Insert: TMPRSS2
Vector Backbone Description: Vector Backbone:pLEX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed.
Proper citation: RRID:Addgene_158457 Copy
Vector Backbone Description: Backbone Marker:EZbiolab; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Bacterial vector for DNA production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22453276
Comments: Please cite the following article in any publications where this construct is utilized:
E.Y.D. Chua, D. Vasudevan, G.E. Davey, B. Wu & C.A. Davey. 2012. The Mechanics Behind DNA Sequence-Dependent Properties of the Nucleosome. Nucleic Acids Res. 40(13): 6338-6352.
Proper citation: RRID:Addgene_158572 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F.
Proper citation: RRID:Addgene_158628 Copy
Vector Backbone Description: Vector Backbone:pXPR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33606977
Comments: For questions regarding use of this plasmid, please contact John Doench.
Please visit https://www.biorxiv.org/content/10.1101/2020.05.17.100818v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_158581 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 position (Q93E, Q198K, and S409F). This plasmid has an additional Q148A and Q271A mutation. For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection.
Proper citation: RRID:Addgene_158639 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 2 positions (Q198K and S409F). For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection.
Proper citation: RRID:Addgene_158635 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33740397
Comments: The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. This plasmid has an additional Q148A mutation. For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection.
Proper citation: RRID:Addgene_158636 Copy
Species: Synthetic
Genetic Insert: natR412 guide
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: GTACCGCACCAGTGTCCCGG
Proper citation: RRID:Addgene_162042 Copy
Species: Synthetic
Genetic Insert: kanR468 guide
Vector Backbone Description: Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34042294
Comments: This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: TCCATGTTGGAATTTAATCG
Proper citation: RRID:Addgene_162041 Copy
Species: Homo sapiens
Genetic Insert: INPP5D
Vector Backbone Description: Vector Backbone:eGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30487552
Proper citation: RRID:Addgene_161998 Copy
Species: Mus musculus
Genetic Insert: Cas9-2a-blasticidin S deaminase
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:8504; Vector Backbone:pLX311; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33497609
Proper citation: RRID:Addgene_162074 Copy
Vector Backbone Description: Backbone Size:5536; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD122.11, Ligation number L4040.
Proper citation: RRID:Addgene_1621 Copy
Species: Homo sapiens
Genetic Insert: BRIT1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16872911
Proper citation: RRID:Addgene_16205 Copy
Species: Mus musculus
Genetic Insert: Per2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4500; Vector Backbone:pCMV-Sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9428527
Proper citation: RRID:Addgene_16204 Copy
Species: Caenorhabditis elegans
Genetic Insert: Caenorhabditis elegans SLOwpoke potassium channel
Vector Backbone Description: Backbone Size:3200; Vector Backbone:pOX; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10903569
Proper citation: RRID:Addgene_16202 Copy
Vector Backbone Description: Vector Backbone:pLEX304-NG; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33712589
Comments: Please visit https://doi.org/10.1101/851410 for bioRxiv preprint.
Proper citation: RRID:Addgene_162034 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
