Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
MAC-NRP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_158384 | NRP1 | Homo sapiens | Ampicillin | PMID:32778839 | Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:15 | 3 | ||
|
pYPQ-dpcoCas9-Act3.0 Resource Report Resource Website 1+ mentions |
RRID:Addgene_158408 | dpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter | Synthetic | Spectinomycin | PMID:34168320 | Please note: This plasmid is prone to recombination in Agrobacterium. Users are recommended to use plasmid 158414 | Vector Backbone:pYPQ173; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin | 2026-08-15 01:08:16 | 2 | |
|
pLEX307-ACE2-blast Resource Report Resource Website 1+ mentions |
RRID:Addgene_158449 | ACE2 | Homo sapiens | Ampicillin | The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed. | Vector Backbone:pLEX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:16 | 2 | ||
|
pDONR221-TMPRSS11D Resource Report Resource Website 1+ mentions |
RRID:Addgene_158447 | TMPRSS11D | Homo sapiens | Kanamycin | The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed. | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:16 | 2 | ||
|
pLEX307-TMPRSS2-puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_158457 | TMPRSS2 | Homo sapiens | Ampicillin | The authors have noticed that recombination within the pLEX307 backbone can occur. All users are advised to sequence the vectors and restriction digest them and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred, it is typically between the viral LTR elements in the vector, although recombination between the gateway cloning sites has also been observed. | Vector Backbone:pLEX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:16 | 1 | ||
|
601L-145-8X Resource Report Resource Website 1+ mentions |
RRID:Addgene_158572 | Ampicillin | PMID:22453276 | Please cite the following article in any publications where this construct is utilized: E.Y.D. Chua, D. Vasudevan, G.E. Davey, B. Wu & C.A. Davey. 2012. The Mechanics Behind DNA Sequence-Dependent Properties of the Nucleosome. Nucleic Acids Res. 40(13): 6338-6352. | Backbone Marker:EZbiolab; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Bacterial vector for DNA production; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:18 | 2 | |||
|
pEN_TT 3xFLAG-MAVS Resource Report Resource Website 1+ mentions |
RRID:Addgene_158628 | MAVS | Homo sapiens | Gentamicin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. | Backbone Marker:Addgene #83274; Vector Backbone:pEN_TTmiR2c_3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:08:19 | 1 | |
|
pRDA_256 Resource Report Resource Website 1+ mentions |
RRID:Addgene_158581 | Ampicillin | PMID:33606977 | For questions regarding use of this plasmid, please contact John Doench. Please visit https://www.biorxiv.org/content/10.1101/2020.05.17.100818v1 for bioRxiv preprint. | Vector Backbone:pXPR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Cas9 D10A | 2026-08-15 01:08:18 | 4 | ||
|
pSLIK 3xFLAG-MAVS-Ala148,Ala271 hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_158639 | MAVS | Homo sapiens | Ampicillin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 3 position (Q93E, Q198K, and S409F). This plasmid has an additional Q148A and Q271A mutation. For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection. | Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Q148A/Q271A | 2026-08-15 01:08:19 | 1 |
|
pSLIK 3xFLAG-MAVS-Gln93 hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_158635 | MAVS | Homo sapiens | Ampicillin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 2 positions (Q198K and S409F). For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection. | Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | E93Q | 2026-08-15 01:08:19 | 1 |
|
pSLIK 3xFLAG-MAVS-Ala148 hygro Resource Report Resource Website 1+ mentions |
RRID:Addgene_158636 | MAVS | Homo sapiens | Ampicillin | PMID:33740397 | The plasmid differs from the MAVS reference sequence at 3 positions: Q93E, Q198K, and S409F. This plasmid has an additional Q148A mutation. For pSLIK vectors, it is recommended to use zeocin in addition to ampicillin for bacterial selection. | Backbone Marker:Addgene #25737; Vector Backbone:pSLIK hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Q148A | 2026-08-15 01:08:19 | 1 |
|
pML104-natR412 Resource Report Resource Website 1+ mentions |
RRID:Addgene_162042 | natR412 guide | Synthetic | Ampicillin | PMID:34042294 | This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: GTACCGCACCAGTGTCCCGG | Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:59 | 1 | |
|
pML107-kanR468 Resource Report Resource Website 1+ mentions |
RRID:Addgene_162041 | kanR468 guide | Synthetic | Ampicillin | PMID:34042294 | This plasmid is derived from Addgene plasmid #67639 pML107 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: TCCATGTTGGAATTTAATCG | Backbone Size:12367; Vector Backbone:pML107; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:59 | 1 | |
|
INPP5D-eGFP WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_161998 | INPP5D | Homo sapiens | Kanamycin | PMID:30487552 | Vector Backbone:eGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:08:58 | 1 | ||
|
pSCAR_Cas9-blast_GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_162074 | Cas9-2a-blasticidin S deaminase | Mus musculus | Ampicillin | PMID:33497609 | Backbone Marker:Broad Institute; Backbone Size:8504; Vector Backbone:pLX311; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | codon-optimized for expression in M. musculus | 2026-08-15 01:08:59 | 4 | |
|
L4040 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1621 | Ampicillin | See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD122.11, Ligation number L4040. | Backbone Size:5536; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:59 | 1 | ||||
|
pMSCVpuro BRIT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_16205 | BRIT1 | Homo sapiens | Ampicillin | PMID:16872911 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:59 | 1 | ||
|
pCMV Sport2 mPer2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_16204 | Per2 | Mus musculus | Ampicillin | PMID:9428527 | Backbone Marker:Invitrogen; Backbone Size:4500; Vector Backbone:pCMV-Sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:59 | 2 | ||
|
pOX + nSlo2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_16202 | Caenorhabditis elegans SLOwpoke potassium channel | Caenorhabditis elegans | Ampicillin | PMID:10903569 | Backbone Size:3200; Vector Backbone:pOX; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:08:59 | 1 | |
|
pLEX304-mNeonGreen Resource Report Resource Website 1+ mentions |
RRID:Addgene_162034 | Ampicillin | PMID:33712589 | Please visit https://doi.org/10.1101/851410 for bioRxiv preprint. | Vector Backbone:pLEX304-NG; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:08:59 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
