Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 239 showing 4761 ~ 4780 out of 12,972 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/223667

Species: Mus musculus
Genetic Insert: mTph2 promoter
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805

Proper citation: RRID:Addgene_223667 Copy   


http://www.addgene.org/224756

Species: Mus musculus
Genetic Insert: Potassium channel subfamily K member 2
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224756 Copy   


http://www.addgene.org/224754

Species: Mus musculus
Genetic Insert: Potassium channel subfamily K member 2
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224754 Copy   


http://www.addgene.org/223666

Species: Mus musculus
Genetic Insert: mTph2 promoter
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805

Proper citation: RRID:Addgene_223666 Copy   


  • RRID:Addgene_223663

http://www.addgene.org/223663

Species: Mus musculus
Genetic Insert: mTph2 promoter
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805

Proper citation: RRID:Addgene_223663 Copy   


  • RRID:Addgene_225343

http://www.addgene.org/225343

Species: Mus musculus
Genetic Insert: Luciferase shRNA
Vector Backbone Description: Vector Backbone:pAAV-CBA-miR-E ; Vector Types:Mammalian Expression, AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36610398

Proper citation: RRID:Addgene_225343 Copy   


http://www.addgene.org/223518

Species: Mus musculus
Genetic Insert: GSDME
Vector Backbone Description: Vector Backbone:pLVX-puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32188940

Proper citation: RRID:Addgene_223518 Copy   


http://www.addgene.org/223227

Species: Mus musculus
Genetic Insert: Fev
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pAAV-U6-sgRNA-hSyn-mCherry-KASH; Vector Types:Mammalian Expression, Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805
Comments: gRNA target sequence: GCCGCGCCACCTCGTCCGGGTCGG

Proper citation: RRID:Addgene_223227 Copy   


http://www.addgene.org/223226

Species: Mus musculus
Genetic Insert: Nr1d1
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pAAV-U6-sgRNA-hSyn-mCherry-KASH; Vector Types:Mammalian Expression, Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39147805

Proper citation: RRID:Addgene_223226 Copy   


http://www.addgene.org/224747

Species: Mus musculus
Genetic Insert: Potassium channel subfamily K member 2
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224747 Copy   


http://www.addgene.org/224745

Species: Mus musculus
Genetic Insert: Potassium channel subfamily K member 2
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224745 Copy   


  • RRID:Addgene_224767

http://www.addgene.org/224767

Species: Mus musculus
Genetic Insert: Potassium channel subfamily member 4
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224767 Copy   


http://www.addgene.org/224768

Species: Mus musculus
Genetic Insert: Potassium channel subfamily member 4
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224768 Copy   


  • RRID:Addgene_224766

http://www.addgene.org/224766

Species: Mus musculus
Genetic Insert: Potassium channel subfamily member 4
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224766 Copy   


http://www.addgene.org/224753

Species: Mus musculus
Genetic Insert: Potassium channel subfamily K member 2
Vector Backbone Description: Vector Backbone:pGEMHE; Vector Types:In vitro transcription for Oocyte expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224753 Copy   


http://www.addgene.org/224779

Species: Mus musculus
Genetic Insert: Tandem TREK-1 S131C-S131C)
Vector Backbone Description: Vector Backbone:pIRES2-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224779 Copy   


http://www.addgene.org/224777

Species: Mus musculus
Genetic Insert: Tandem TREK-1 (S131C-wt)
Vector Backbone Description: Vector Backbone:pIRES2-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224777 Copy   


http://www.addgene.org/224775

Species: Mus musculus
Genetic Insert: Potassium channel subfamily K member 2
Vector Backbone Description: Vector Backbone:pIRES2-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39029456

Proper citation: RRID:Addgene_224775 Copy   


  • RRID:Addgene_211369

http://www.addgene.org/211369

Species: Mus musculus
Genetic Insert: Qa-1b
Vector Backbone Description: Vector Backbone:pET-21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_211369 Copy   


  • RRID:Addgene_246546

http://www.addgene.org/246546

Species: Mus musculus
Genetic Insert: Reck gRNA
Vector Backbone Description: Vector Backbone:pX459; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40914247
Comments: CBh-SpCas9-T2A-Puro cassette on backbone

Proper citation: RRID:Addgene_246546 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X