Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: gRNAs for SaCas9 targeting Ai9 locus
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686
Proper citation: RRID:Addgene_78604 Copy
Species: Synthetic
Genetic Insert: CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26721686
Comments: gRNA targeting sequences:
CAGTAATGTGTCATACCTTC;
ATATAATAGAAATTATTCAT
Proper citation: RRID:Addgene_78606 Copy
Species: Synthetic
Genetic Insert: J101-rbs32-arsR-t-ParsR
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78635 Copy
Species: Synthetic
Genetic Insert: 30hrpR-32hrpS-t-hrpL-30gfp-t
Vector Backbone Description: Backbone Marker:Wang Lab; Vector Backbone:pBW100ParsR; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78637 Copy
Species: Synthetic
Genetic Insert: araC-PBAD
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78639 Copy
Species: Synthetic
Genetic Insert: J106-30hrpR-32hrpS-t-hrpL-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78651 Copy
Species: Synthetic
Genetic Insert: J105-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78644 Copy
Species: Synthetic
Genetic Insert: J106-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78645 Copy
Species: Synthetic
Genetic Insert: J116-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78642 Copy
Species: Synthetic
Genetic Insert: J114-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78641 Copy
Species: Synthetic
Genetic Insert: J114-30hrpR-32hrpS-t-hrpL-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030903
Proper citation: RRID:Addgene_78647 Copy
Species: Synthetic
Genetic Insert: Insulated J23100 Promoter
Vector Backbone Description: Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28422998
Proper citation: RRID:Addgene_78666 Copy
Species: Synthetic
Genetic Insert: BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0033-GFP(LVA)-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78699 Copy
Species: Synthetic
Genetic Insert: BBa_J23109-BBa_B0034-luxR-Terminator-pLux-BBa_B0033-GFP-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78695 Copy
Species: Synthetic
Genetic Insert: BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0034-GFP-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78697 Copy
Species: Synthetic
Genetic Insert: BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0034-GFP(LVA)-Terminator
Vector Backbone Description: Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27111289
Proper citation: RRID:Addgene_78696 Copy
Species: Synthetic
Genetic Insert: Insulated pTet Promoter
Vector Backbone Description: Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28422998
Proper citation: RRID:Addgene_78680 Copy
Species: Synthetic
Genetic Insert: Insulated pBAD Promoter
Vector Backbone Description: Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28422998
Proper citation: RRID:Addgene_78677 Copy
Species: Synthetic
Genetic Insert: Insulated pBAD Promoter
Vector Backbone Description: Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28422998
Proper citation: RRID:Addgene_78676 Copy
Species: Synthetic
Genetic Insert: Insulated pTet Promoter
Vector Backbone Description: Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28422998
Proper citation: RRID:Addgene_78678 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
