Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 239 showing 4761 ~ 4780 out of 69,553 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_12676

    This resource has 1+ mentions.

http://www.addgene.org/12676

Species: Homo sapiens
Genetic Insert: RAB9 (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301

Proper citation: RRID:Addgene_12676 Copy   

    • RRID:Addgene_12677

    This resource has 1+ mentions.

http://www.addgene.org/12677

Species: Homo sapiens
Genetic Insert: RAB9 (Homo sapiens)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12070301
Comments: This plasmid contains two tandem copies of the Rab9 gene.

Proper citation: RRID:Addgene_12677 Copy   

    • RRID:Addgene_126873

    This resource has 1+ mentions.

http://www.addgene.org/126873

Species: Homo sapiens
Genetic Insert: GAR1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20351177

Proper citation: RRID:Addgene_126873 Copy   

http://www.addgene.org/126879

Species: Homo sapiens
Genetic Insert: Human Cdc45
Vector Backbone Description: Backbone Size:3766; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27189187

Proper citation: RRID:Addgene_126879 Copy   

    • RRID:Addgene_126950

http://www.addgene.org/126950

Species: Homo sapiens
Genetic Insert: spacer against human genome with GC at cut site
Vector Backbone Description: Backbone Marker:Keith Joung; Backbone Size:2259; Vector Backbone:pSQT1313; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753928
Comments: This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320.

Proper citation: RRID:Addgene_126950 Copy   

    • RRID:Addgene_126953

http://www.addgene.org/126953

Species: Homo sapiens
Genetic Insert: spacer against human genome with CG at cut site
Vector Backbone Description: Backbone Marker:Keith Joung; Backbone Size:2259; Vector Backbone:pSQT1313; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753928
Comments: This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320.

Proper citation: RRID:Addgene_126953 Copy   

    • RRID:Addgene_126954

http://www.addgene.org/126954

Species: Homo sapiens
Genetic Insert: EGFP-SUMO interacting motif (SIM) from PIASx
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126954 Copy   

    • RRID:Addgene_126951

http://www.addgene.org/126951

Species: Homo sapiens
Genetic Insert: spacer against human genome with GA at cut site
Vector Backbone Description: Backbone Marker:Keith Joung; Backbone Size:2259; Vector Backbone:pSQT1313; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753928
Comments: This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320.

Proper citation: RRID:Addgene_126951 Copy   

    • RRID:Addgene_126955

http://www.addgene.org/126955

Species: Homo sapiens
Genetic Insert: EGFP-SUMO interacting motif (SIM) from PIASx
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126955 Copy   

    • RRID:Addgene_126948

http://www.addgene.org/126948

Species: Homo sapiens
Genetic Insert: 10 repeats of human SUMO3 each separated by (GGS)4
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126948 Copy   

    • RRID:Addgene_126946

    This resource has 1+ mentions.

http://www.addgene.org/126946

Species: Homo sapiens
Genetic Insert: 10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126946 Copy   

    • RRID:Addgene_126947

http://www.addgene.org/126947

Species: Homo sapiens
Genetic Insert: 5 repeats of SUMO interacting motif (SIM) from PIASx, each separated by (GGS)4
Vector Backbone Description: Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126947 Copy   

    • RRID:Addgene_126923

http://www.addgene.org/126923

Species: Homo sapiens
Genetic Insert: 5 repeats of human SUMO3 and 10 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:6600; Vector Backbone:pMal-tev; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_126923 Copy   

    • RRID:Addgene_127172

    This resource has 1+ mentions.

http://www.addgene.org/127172

Species: Homo sapiens
Genetic Insert: GFP-RelA
Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_127172 Copy   

http://www.addgene.org/127162

Species: Homo sapiens
Genetic Insert: MB21D1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31113940

Proper citation: RRID:Addgene_127162 Copy   

    • RRID:Addgene_127161

    This resource has 1+ mentions.

http://www.addgene.org/127161

Species: Homo sapiens
Genetic Insert: MB21D1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31113940

Proper citation: RRID:Addgene_127161 Copy   

    • RRID:Addgene_127154

http://www.addgene.org/127154

Species: Homo sapiens
Genetic Insert: PLK1-mCherry
Vector Backbone Description: Backbone Size:4091; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31042116

Proper citation: RRID:Addgene_127154 Copy   

http://www.addgene.org/127152

Species: Homo sapiens
Genetic Insert: Abeta(MC1-40)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_127152 Copy   

http://www.addgene.org/127151

Species: Homo sapiens
Genetic Insert: Abeta(MC1-42)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33793198

Proper citation: RRID:Addgene_127151 Copy   

    • RRID:Addgene_127150

http://www.addgene.org/127150

Species: Homo sapiens
Genetic Insert: 3 copies of human SUMO1 separated by (GGS)4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pC1-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27374333

Proper citation: RRID:Addgene_127150 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch