Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 239 showing 4761 ~ 4780 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/174686

Species: Prevotella bryantii B14
Genetic Insert: huPb2Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92272) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174686 Copy   


  • RRID:Addgene_174687

http://www.addgene.org/174687

Species: Thiomicrospira sp. XS5
Genetic Insert: huTsCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92267) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174687 Copy   


  • RRID:Addgene_174658

http://www.addgene.org/174658

Species: Francisella novicida
Genetic Insert: FnCas12a
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33608525

Proper citation: RRID:Addgene_174658 Copy   


http://www.addgene.org/174799

Species: Homo sapiens
Genetic Insert: PARP1-K893I
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, K893I) (see PMID: 8473297 for detail about the mutation)

Proper citation: RRID:Addgene_174799 Copy   


http://www.addgene.org/174793

Species: Homo sapiens
Genetic Insert: PARP1-W318R
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (W318R, V762A) (see PMID: 26626480 for detail about the mutation)

Proper citation: RRID:Addgene_174793 Copy   


http://www.addgene.org/174795

Species: Homo sapiens
Genetic Insert: PARP1-A762V
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (see PMID: 20399804 for detail about the mutation)

Proper citation: RRID:Addgene_174795 Copy   


http://www.addgene.org/174796

Species: Homo sapiens
Genetic Insert: PARP1-A774L
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, A774L) (*protein expression may be toxic to host, add 10 mM benzamide to all growth media, see PMID: 28695525 for protocol) (see PMID: 26626480 for detail about the mutation)

Proper citation: RRID:Addgene_174796 Copy   


http://www.addgene.org/174797

Species: Homo sapiens
Genetic Insert: PARP1-A870L
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-1014 (V762A, A870L) (*protein expression may be toxic to host, add 10 mM benzamide to all growth media, see PMID: 28695525 for protocol) (see PMID: 26626480 for detail about the mutation)

Proper citation: RRID:Addgene_174797 Copy   


  • RRID:Addgene_174783

http://www.addgene.org/174783

Species: X. perforans
Genetic Insert: GG_XopJ4, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174783 Copy   


  • RRID:Addgene_174785

http://www.addgene.org/174785

Species: N. benthamiana
Genetic Insert: GG_synthesized NbJIM2 (NbJIM2syn)-3xFLAG, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174785 Copy   


  • RRID:Addgene_174777

http://www.addgene.org/174777

Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E/D481V-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174777 Copy   


  • RRID:Addgene_174778

http://www.addgene.org/174778

Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-eGFP, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174778 Copy   


http://www.addgene.org/174813

Species: Homo sapiens
Genetic Insert: ALC1-K77R
Vector Backbone Description: Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-897 (a start codon included in-frame) Please note: Plasmid contains R25P and S743C natural variants in ALC1.

Proper citation: RRID:Addgene_174813 Copy   


http://www.addgene.org/174814

Species: Homo sapiens
Genetic Insert: ALC1-E175Q
Vector Backbone Description: Vector Backbone:pET41; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-897 (a start codon included in-frame). Please note: Plasmid contains R25P and S743C natural variants in ALC1.

Proper citation: RRID:Addgene_174814 Copy   


http://www.addgene.org/17471

Genetic Insert: Enhanced green fluorescent protein shRNA #2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2556; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Comments: shRNA sequence is- 5'-CCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT

Proper citation: RRID:Addgene_17471 Copy   


  • RRID:Addgene_17473

    This resource has 1+ mentions.

http://www.addgene.org/17473

Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2240; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17473 Copy   


  • RRID:Addgene_174772

http://www.addgene.org/174772

Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E-4xMyc, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174772 Copy   


  • RRID:Addgene_174773

http://www.addgene.org/174773

Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-L17E/D481V-4xMyc, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174773 Copy   


  • RRID:Addgene_174774

http://www.addgene.org/174774

Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174774 Copy   


  • RRID:Addgene_174775

http://www.addgene.org/174775

Species: N. benthamiana
Genetic Insert: GG_NbZAR1syn-D481V-6xHA, Kmr plant selection marker
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_174775 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X