Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
DsRed-rab9 DN Resource Report Resource Website 1+ mentions |
RRID:Addgene_12676 | RAB9 (Homo sapiens) | Homo sapiens | Kanamycin | PMID:12070301 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | changed serine 21 to asparagine | 2026-08-15 01:04:29 | 4 | |
|
DsRed-rab9 WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_12677 | RAB9 (Homo sapiens) | Homo sapiens | Kanamycin | PMID:12070301 | This plasmid contains two tandem copies of the Rab9 gene. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:p-DsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:04:29 | 7 | |
|
pcDNA3.1 3xF-GAR1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_126873 | GAR1 | Homo sapiens | Ampicillin | PMID:20351177 | Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 1 | ||
|
pRSFDuet1-Cdc45 (delta 154–164) Resource Report Resource Website |
RRID:Addgene_126879 | Human Cdc45 | Homo sapiens | Kanamycin | PMID:27189187 | Backbone Size:3766; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | deletion amino acid 154-164 | 2026-08-15 01:04:30 | 0 | |
|
pTBL322 GC Resource Report Resource Website |
RRID:Addgene_126950 | spacer against human genome with GC at cut site | Homo sapiens | Ampicillin | PMID:33753928 | This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320. | Backbone Marker:Keith Joung; Backbone Size:2259; Vector Backbone:pSQT1313; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | |
|
pTBL602 CG Resource Report Resource Website |
RRID:Addgene_126953 | spacer against human genome with CG at cut site | Homo sapiens | Ampicillin | PMID:33753928 | This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320. | Backbone Marker:Keith Joung; Backbone Size:2259; Vector Backbone:pSQT1313; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | |
|
GFP-(SIM)1 Resource Report Resource Website |
RRID:Addgene_126954 | EGFP-SUMO interacting motif (SIM) from PIASx | Homo sapiens | Ampicillin | PMID:27374333 | Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | ||
|
pTBL581 GA Resource Report Resource Website |
RRID:Addgene_126951 | spacer against human genome with GA at cut site | Homo sapiens | Ampicillin | PMID:33753928 | This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320. | Backbone Marker:Keith Joung; Backbone Size:2259; Vector Backbone:pSQT1313; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | |
|
GFP-(SIM)3 Resource Report Resource Website |
RRID:Addgene_126955 | EGFP-SUMO interacting motif (SIM) from PIASx | Homo sapiens | Ampicillin | PMID:27374333 | Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | ||
|
(SUMO)10 Resource Report Resource Website |
RRID:Addgene_126948 | 10 repeats of human SUMO3 each separated by (GGS)4 | Homo sapiens | Ampicillin | PMID:27374333 | Backbone Marker:unknown; Backbone Size:5000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | ||
|
(SIM)10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_126946 | 10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4 | Homo sapiens | Ampicillin | PMID:27374333 | Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 1 | ||
|
(SIM)5 Resource Report Resource Website |
RRID:Addgene_126947 | 5 repeats of SUMO interacting motif (SIM) from PIASx, each separated by (GGS)4 | Homo sapiens | Ampicillin | PMID:27374333 | Backbone Marker:unknown; Backbone Size:6000; Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:30 | 0 | ||
|
(SUMO)5-(SIM)10 Resource Report Resource Website |
RRID:Addgene_126923 | 5 repeats of human SUMO3 and 10 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4 | Homo sapiens | Ampicillin | PMID:27374333 | Backbone Marker:NEB; Backbone Size:6600; Vector Backbone:pMal-tev; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | internal BamHI site between (SUMO)5 and (SIM)10 | 2026-08-15 01:04:30 | 0 | |
|
p65-mNeonGreen Resource Report Resource Website 1+ mentions |
RRID:Addgene_127172 | GFP-RelA | Homo sapiens | Ampicillin | PMID:31626775 | Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint. | Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:33 | 1 | |
|
pRSFDuet-sumo-h-cGASCD(K427E/K428E) Resource Report Resource Website |
RRID:Addgene_127162 | MB21D1 | Homo sapiens | Kanamycin | PMID:31113940 | Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | None | 2026-08-15 01:04:32 | 0 | |
|
pRSFDuet-sumo-h-cGAS Resource Report Resource Website 1+ mentions |
RRID:Addgene_127161 | MB21D1 | Homo sapiens | Kanamycin | PMID:31113940 | Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | None | 2026-08-15 01:04:32 | 1 | |
|
pCS2-PLK1-mCherry Resource Report Resource Website |
RRID:Addgene_127154 | PLK1-mCherry | Homo sapiens | Ampicillin | PMID:31042116 | Backbone Size:4091; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:32 | 0 | ||
|
pET-Sac-Abeta(MC1-40) Resource Report Resource Website |
RRID:Addgene_127152 | Abeta(MC1-40) | Homo sapiens | Ampicillin | Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:32 | 0 | |||
|
pET-Sac-Abeta(MC1-42) Resource Report Resource Website |
RRID:Addgene_127151 | Abeta(MC1-42) | Homo sapiens | Ampicillin | PMID:33793198 | Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:04:32 | 0 | ||
|
RFP-(SUMO)3 Resource Report Resource Website |
RRID:Addgene_127150 | 3 copies of human SUMO1 separated by (GGS)4 | Homo sapiens | Kanamycin | PMID:27374333 | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pC1-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:04:32 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
