Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,517 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pZac2.1 U6-SaAi9L-U6-SaAi9R
 
Resource Report
Resource Website 		RRID:Addgene_78604 gRNAs for SaCas9 targeting Ai9 locus Synthetic Ampicillin PMID:26721686 Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
 
Resource Report
Resource Website 		RRID:Addgene_78606 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2 Synthetic Ampicillin PMID:26721686 gRNA targeting sequences: CAGTAATGTGTCATACCTTC; ATATAATAGAAATTATTCAT Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0
pBW100ParsR
 
Resource Report
Resource Website 		RRID:Addgene_78635 J101-rbs32-arsR-t-ParsR Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW102ParsR-Amp32C
 
Resource Report
Resource Website 		RRID:Addgene_78637 30hrpR-32hrpS-t-hrpL-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:Wang Lab; Vector Backbone:pBW100ParsR; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW112pBAD-hrpV
 
Resource Report
Resource Website 		RRID:Addgene_78639 araC-PBAD Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW216J106-Amp32C
 
Resource Report
Resource Website 		RRID:Addgene_78651 J106-30hrpR-32hrpS-t-hrpL-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW205J105-gfp
 
Resource Report
Resource Website 		RRID:Addgene_78644 J105-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW206J106-gfp
 
Resource Report
Resource Website 		RRID:Addgene_78645 J106-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW203J116-gfp
 
Resource Report
Resource Website 		RRID:Addgene_78642 J116-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW202J114-gfp
 
Resource Report
Resource Website 		RRID:Addgene_78641 J114-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
pBW212J114-Amp32C
 
Resource Report
Resource Website 		RRID:Addgene_78647 J114-30hrpR-32hrpS-t-hrpL-30gfp-t Synthetic Kanamycin PMID:25030903 Backbone Marker:BioBrick vector, IGEM registry; Vector Backbone:pSB3K3; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:20:25 0
36INS-J23100_AB
 
Resource Report
Resource Website 		RRID:Addgene_78666 Insulated J23100 Promoter Synthetic Ampicillin PMID:28422998 Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0
BC-A1-011
 
Resource Report
Resource Website 		RRID:Addgene_78699 BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0033-GFP(LVA)-Terminator Synthetic Chloramphenicol PMID:27111289 Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:26 0
BC-A1-008
 
Resource Report
Resource Website 		RRID:Addgene_78695 BBa_J23109-BBa_B0034-luxR-Terminator-pLux-BBa_B0033-GFP-Terminator Synthetic Chloramphenicol PMID:27111289 Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:26 0
BC-A1-010
 
Resource Report
Resource Website 		RRID:Addgene_78697 BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0034-GFP-Terminator Synthetic Chloramphenicol PMID:27111289 Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:26 0
BC-A1-009
 
Resource Report
Resource Website 		RRID:Addgene_78696 BBa_J23100-BBa_B0034-luxR(G2F)-Terminator-pLux-BBa_B0034-GFP(LVA)-Terminator Synthetic Chloramphenicol PMID:27111289 Backbone Marker:Registry of Standardized Biological Parts; Backbone Size:2047; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:26 0
36INS-pTet_FB
 
Resource Report
Resource Website 		RRID:Addgene_78680 Insulated pTet Promoter Synthetic Ampicillin PMID:28422998 Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0
36INS2-pBAD_GB
 
Resource Report
Resource Website 		RRID:Addgene_78677 Insulated pBAD Promoter Synthetic Ampicillin PMID:28422998 Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0
36INS2-pBAD_FB
 
Resource Report
Resource Website 		RRID:Addgene_78676 Insulated pBAD Promoter Synthetic Ampicillin PMID:28422998 Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0
36INS-pTet_AB
 
Resource Report
Resource Website 		RRID:Addgene_78678 Insulated pTet Promoter Synthetic Ampicillin PMID:28422998 Backbone Size:2023; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:20:25 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch