Plasmids   Select Another Resource Report Type

http://www.addgene.org/45699

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45699 Copy   

•   Source: Addgene

http://www.addgene.org/45698

Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45698 Copy   

•   Source: Addgene

http://www.addgene.org/45570

Species: Homo sapiens
Genetic Insert: TRIM28
Vector Backbone Description: Backbone Marker:Amersham GE Healthcare; Backbone Size:5000; Vector Backbone:pGEX-5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21940674
Comments: Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28 (Addgene plasmid #45569). A full length TRIM28 DNA fragment was then generated from pKH3-TRIM28 by PCR and cloned into pGEX-5X.

Proper citation: RRID:Addgene_45570 Copy   

•   Source: Addgene

http://www.addgene.org/45604

Genetic Insert: FRT-cat-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked cat cassette. The cat cassette originally came from pSC140. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.

Proper citation: RRID:Addgene_45604 Copy   

•   Source: Addgene

http://www.addgene.org/45606

Species: Synthetic
Genetic Insert: FDA60
Vector Backbone Description: Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_45606 Copy   

•   Source: Addgene

http://www.addgene.org/45605

Genetic Insert: FRT-kan-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.

Proper citation: RRID:Addgene_45605 Copy   

•   Source: Addgene

http://www.addgene.org/45567

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5729; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid pIRES-EGFP-puro was constructed containing the Phcmv promoter followed by unique restriction sites (NheI, XhoI, and SacI) for insertion of genes. Downstream, an IRES from the encephalomyocarditis virus directs the translation of EGFP-puro from the same mRNA. Addgene's sequencing results found differences compared to the depositing lab's sequence in the 3' region of the puro resistance marker. The resulting protein sequence matches NCBI WP_055528321.1 and should be functional.

Proper citation: RRID:Addgene_45567 Copy   

•   Source: Addgene

http://www.addgene.org/45569

Species: Homo sapiens
Genetic Insert: TRIM28
Vector Backbone Description: Backbone Marker:Addgene plasmid Plasmid 12555; Backbone Size:4800; Vector Backbone:pKH3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21940674
Comments: Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28.

Proper citation: RRID:Addgene_45569 Copy   

•   Source: Addgene

http://www.addgene.org/45602

Species: Mus musculus
Genetic Insert: Diap3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45602 Copy   

•   Source: Addgene

http://www.addgene.org/45561

Genetic Insert: Puromycin N-acetyl transferase
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bifunctional selection protein; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11515370
Comments: Plasmid pEGFP-puro was constructed by PCR amplification of PuroR coding sequences from pPur (Clontech Laboratories, Palo Alto CA, USA) using upstream (5'-AAGTCCGGACTCAGATCTAGGAGACGACCTTCCATGACCGAGT-3') and downstream (5'-GTTATCTAGATCCGGTGGATCCCGGGCACCGGGCTTGCGGGTCATGCACCA-3') primers, digestion of the PCR product with BglII andBamHI, and ligation into BglII/BamHI digested pEGFP-C1 (Clontech Laboratories). To construct a fusion protein containing both EGFP and PuroR sequences, PuroR coding sequences were ligated into an existing expression cassette for EGFP. The resulting fusion protein was designated EGFP-puro and is contained in plasmid pEGFP-puro. This plasmid contains the strong human cytomegalovirus immediate early promoter (Phcmv), the EGFP puro open reading frame, and the simian virus 40 (SV40) polyadenylation signal. The EGFP-puro protein contains the first 245 amino acids of EGFP. The C-terminal five amino acids of EGFP were deleted and replaced by four linker-encoded amino acids, followed by the complete 200-amino-acid PuroR sequence. The C-terminus is formed by 11 amino acids encoded by vector sequences. The resulting fusion protein (EGFP-puro) confers both green fluorescence and resistance to puromycin when expressed in mammalian cells.

Proper citation: RRID:Addgene_45561 Copy   

•   Source: Addgene

http://www.addgene.org/45769

Species: Homo sapiens
Genetic Insert: hE-cadherin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381089
Comments: Partial cDNA for human E-cadherin was provided by D. Rimm (Yale University, New Haven, CT) and subcloned into the pcDNA3 mammalian expression vector (Invitrogen), to generate Addgene plasmid 45772. Sequence analysis revealed that the 3′ end of the gene was missing after nucleotide 2644 (according to EMBL/GenBank/DDBJ under accession number L08599). This resulted in a truncation of the last 35 amino acids of the E-cadherin cytoplasmic domain and, as a result, did not contain the β-catenin binding region, as defined by Stappert and Kemler 1994. The COOH terminus of this truncation mutant (E-cadherin Δ β-catenin) ends at amino acid 844 (NH3-ASLSSD); the frameshift added a single histidine residue before a stop codon is introduced. The full-length human E-cadherin was reengineered using RNA from human A431 cells and the RT-PCR method (Primer A, 5′-TGACACCCGGGACAACGTTTATTA-3′, and Primer C, 5′-CTAGTCTAGACCCCTAGTGGTCCTCG-3′) to generate a 425-bp fragment encoding the missing COOH-terminal residues. This fragment was sub-cloned into the truncated hEcad-Δ 35/pcDNA3 vector (Addgene plasmid 45772) to generate full-length hEcad/pcDNA3 (Addgene plasmid 45769).

Proper citation: RRID:Addgene_45769 Copy   

•   Source: Addgene

http://www.addgene.org/45801

Vector Backbone Description: Backbone Size:3019; Vector Backbone:pBSTNAV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23804766

Proper citation: RRID:Addgene_45801 Copy   

•   Source: Addgene

http://www.addgene.org/45760

Species: Rattus norvegicus
Genetic Insert: alpha 1A AR
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1970822

Proper citation: RRID:Addgene_45760 Copy   

•   Source: Addgene

http://www.addgene.org/45763

Species: Homo sapiens
Genetic Insert: lincRNA-RoR cDNA
Vector Backbone Description: Backbone Marker:Bob Weinberg; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057500
Comments: Note that though there are some small discrepancies between Addgene's quality control sequence and the depositor's assembled sequence, they do not affect function.

Proper citation: RRID:Addgene_45763 Copy   

•   Source: Addgene

http://www.addgene.org/45911

Species: Homo sapiens
Genetic Insert: Syntaxin 17
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45911 Copy   

•   Source: Addgene

http://www.addgene.org/45759

Species: Rattus norvegicus
Genetic Insert: AT1R DRY-AAY
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12746278
Comments: The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA) N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding.

Proper citation: RRID:Addgene_45759 Copy   

•   Source: Addgene

http://www.addgene.org/45913

Species: Mus musculus
Genetic Insert: vesicle-associated membrane protein 7
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45913 Copy   

•   Source: Addgene

http://www.addgene.org/45875

Species: Homo sapiens
Genetic Insert: Parkin
Vector Backbone Description: Backbone Size:4731; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23661642

Proper citation: RRID:Addgene_45875 Copy   

•   Source: Addgene

http://www.addgene.org/45910

Species: Homo sapiens
Genetic Insert: Syntaxin 17
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45910 Copy   

•   Source: Addgene

http://www.addgene.org/45876

Species: Homo sapiens
Genetic Insert: Parkin
Vector Backbone Description: Backbone Size:4731; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23661642

Proper citation: RRID:Addgene_45876 Copy   

•   Source: Addgene