Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163577 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: FLP recombinase
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11376165
Proper citation: RRID:Addgene_31130 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Flippase1::PEST
Vector Backbone Description: Vector Backbone:pJFRC7-20XUAS-IVS-mCD8::GFP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21831835
Proper citation: RRID:Addgene_32132 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: synthetic yeast Ubiquitin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5800; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: 2 µm S. cerevisiae origin.
Orientation of insert determined by sequencing.
Proper citation: RRID:Addgene_32175 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: synthetic yeast Ubiquitin
Vector Backbone Description: Backbone Marker:Clontech - Discontinued; Backbone Size:8100; Vector Backbone:pACT2 AD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32170 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: synthetic yeast Ubiquitin
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: CEN4 ARS1 S. cerevisiae replication.
Ubiquitin was amplified using oligos which introduce BamHI sites on either end and cloned in to the BamHI site on the vector. Insertion was confirmed by digests and then orientation confirmed by sequencing.
Proper citation: RRID:Addgene_32173 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: STE2
Vector Backbone Description: Vector Backbone:YCPlac33; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Wildtype STE2 ORF including 1100bp upstream of the start codon (from SalI site) and 200bp downstream of the stop codon (HindIII). The wildtype 1.6kB HindIII fragment encoding STE2 was subcloned from LHP123 into the HindIII site of YCplac33. The upstream promoter sequence was obtained by dropping out the 1260bp EcoRI (upstream)/PstI fragment and ligating in the 2kB EcoRI/PstI fragment from pJR3.
Proper citation: RRID:Addgene_32171 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: STE2
Vector Backbone Description: Vector Backbone:YCPlac33; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: STE2 ORF with a stop codon introduced at aa378. The 1.6kB STE2 378Stop -encoding HindIII fragment was subcloned from LHP147 into the HindIII site of YCplac33. The upstream promoter sequence was obtained by dropping out the 1260bp EcoRI(upstream)/PstI fragment and ligating in the 2KB EcoRI/PstI fragment from pJR3.
Proper citation: RRID:Addgene_32172 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: synthetic yeast Ubiquitin
Vector Backbone Description: Vector Backbone:YEplac195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: A ~1040 bp BamHI / HindIII fragment containing the CUP1 promoter, the synthetic yeast Ub gene and a CYC1 terminator sequence was ligated into the BamHI and HindIII sites of YEplac195. The resulting plasmid is approximately 6.281kb).
K63A mutation was introduced by site-directed mutagenesis of LHP585 (Addgene 32168).
2 µm S. cerevisiae replication.
Proper citation: RRID:Addgene_32166 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: synthetic yeast Ubiquitin
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: BglII-KpnI K48R/K63R fragment of synthetic yeast Ubiquitin cloned into YEp96 (D. Ecker, U PENN).
2 µm S. cerevisiae replication.
Proper citation: RRID:Addgene_32167 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: uba1 yeast
Vector Backbone Description: Vector Backbone:YEplac195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12628920
Comments: A ~1040 bp BamHI / HindIII fragment containing the CUP1 promoter, the synthetic yeast Ub gene and a CYC1 terminator sequence was ligated into the BamHI and HindIII sites of YEplac195. The resulting plasmid is approximately 6.281kb).
2 µm S. cerevisiae replication.
Proper citation: RRID:Addgene_32168 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: synthetic yeast Ubiquitin
Vector Backbone Description: Backbone Marker:Mike Ellison - University of Alberta; Vector Backbone:pES7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: BamHI-KpnI fragment from YEp96 (D. Ecker, U PENN) was cloned into pES7 (Mike Ellison, University of Alberta) cut with BamHI/KpnI.
K63R mutation introduced by quickchange of LHP308 (Addgene plasmid 32151).
2 µm S. cerevisiae origin
Proper citation: RRID:Addgene_32160 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PAN1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: PAN1-HA including 1kB upstream sequence and 280bp downstream sequence of PAN1 ORF.
Proper citation: RRID:Addgene_32159 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: STE2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32158 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: EDE1
Vector Backbone Description: Vector Backbone:YCplac33; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32238 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS23
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: HA tag is likely 3xHA and likely C-terminal
Proper citation: RRID:Addgene_32239 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RSP5
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFastbac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32434 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: INP52
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:YCplac22; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14761940
Comments: INP52 was amplified from yeast genomic DNA using 5′ PstI and 3′ BamHI site-containing oligonucleotides, digested and ligated into PstI- and BamHI-digested YCplac22. The NotI site was inserted at the 5′-end of INP52 via QuikChange™ mutagenesis. A triple HA epitope was ligated into the NotI site to generate pHA-INP52 (LHP1463).
Proper citation: RRID:Addgene_32432 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: YCK2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFastbac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_32433 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 20XUAS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2609; Vector Backbone:pDONR 221 P1-P5r; Vector Types:Gateway MultiSite entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12859 for additional plasmid map.
Proper citation: RRID:Addgene_32302 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
