Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,553 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
 
Resource Report
Resource Website 		RRID:Addgene_127271 ELL2 Met133, 138, 186 to Ileu Homo sapiens Ampicillin PMID:19749764 HA tag after 8th Met in Met 133, 138, 186 to Ileu Backbone Marker:Addgene; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Met133, 138, 186 to Ileu with HA tag after 8th Met 2026-08-15 01:04:34 0
HA tagged Sph ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127270 ELL2 Homo sapiens Ampicillin PMID:19749764 HA tag in ELL2 after 8th Met Backbone Marker:Addgene; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin WT Mets and HA tag at SphI site (8th Met) 2026-08-15 01:04:34 0
Met133ILeu, Met186ILeu ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127264 ELL2 (Met133ILeu, Met186ILeu) Homo sapiens Ampicillin PMID:19749764 see Suppl figure 2 for translation Backbone Marker:Addgene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Two Mets (133,186 )to ILeu Quikchange 2026-08-15 01:04:34 0
Met133I, M1381I, M186I ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127263 ELL2 (Met133ILeu, M1381ILeu, M186ILeu) Homo sapiens Ampicillin PMID:19749764 see Suppl figure 2 for translation Backbone Marker:Addgene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Three Mets (133, 138, 186) to Ileu 2026-08-15 01:04:34 0
Met331Leu ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127262 ELL2 (Met331 to Ileu) Homo sapiens Ampicillin PMID:19749764 see Suppl figure 2 for translation Backbone Marker:Addgene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Met331 to ILeu Quikchange 2026-08-15 01:04:34 0
564aa ELL2 bluescript
 
Resource Report
Resource Website 		RRID:Addgene_127267 ELL2 Homo sapiens Ampicillin PMID:19749764 NH2 ELL2, 564 aa long, terminal 5 aa then stop codon Backbone Marker:Addgene; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Addgene Plasmid 127256--SphI site filled in, then religated; Contains 564 N-terminal amino acids ELL2, terminal 5 aa then stop codon 2026-08-15 01:04:34 0
289aa ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127266 NH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) Homo sapiens Ampicillin PMID:19749764 The XbaI site in Addgene plasmid 127263 was filled in and religated; contains N-terminal ELL2, 289 aa long, terminal S then stop codon. Backbone Marker:Addgene; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Three Mets (133, 138, 186) to Ileu. Contains 289 N-terminal amino acids ELL2, terminal S then stop codon 2026-08-15 01:04:34 0
Met186ILeu ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127261 ELL2 (Met186 to Ileu) Homo sapiens Ampicillin PMID:19749764 see Suppl figure 2 for translation Backbone Marker:Addgene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin Met186 to Ileu Quikchange 2026-08-15 01:04:34 0
frameshift ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127257 ELL2 Homo sapiens Ampicillin PMID:19749764 XhoI filled in, creates new PvuI, frameshifts protein Backbone Marker:Addgene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:in vitro translation; Bacterial Resistance:Ampicillin XhoI site between the 1st &2nd Met was filled in, resulting in frameshift that generates a 58kDa protein (compared to 80kDa full-length) 2026-08-15 01:04:34 0
COOHend ELL2
 
Resource Report
Resource Website 		RRID:Addgene_127255 ELL2 (C-terminal end) Homo sapiens Ampicillin PMID:19749764 Uncertain about protein expression Backbone Marker:Invitrogen; Backbone Size:5800; Vector Backbone:pEF4B; Vector Types:Mammalian Expression, Other; Bacterial Resistance:Ampicillin contains only the last 389 aa 2026-08-15 01:04:34 0
Dom neg CstF64
 
Resource Report
Resource Website 		RRID:Addgene_127250 CstF64 delta 282 Homo sapiens Ampicillin PMID:19749764 Removal of the last 282 aa makes a dominant negative. This plasmid was derived from Addgene Plasmid 127251. Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1-myc/hisB; Vector Types:Mammalian Expression, Other; Bacterial Resistance:Ampicillin insert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTACGCTGCTAGT; lacks the last 282 amino acids 2026-08-15 01:04:34 0
pCDNA3.1-V5-SPR
 
Resource Report
Resource Website 		RRID:Addgene_127236 SPR Homo sapiens Ampicillin PMID:22701522 Backbone Size:5428; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:33 0
pcDNA3.1(+)/AUG-DAP5-3XFLAG
 
Resource Report
Resource Website 		RRID:Addgene_127331 DAP5 Homo sapiens Ampicillin PMID:31171704 Please note: Plasmid contains a 23 nucleotide deletion in the backbone compared to the depositor sequence, which does not affect plasmid function. Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:34 0
pB2AR-miRFP670nano
 
Resource Report
Resource Website 		RRID:Addgene_127442 B2AR-miRFP670nano Homo sapiens Ampicillin PMID:30655515 Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:36 0
pKeratin-miRFP670nano
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127437 Keratin-miRFP670nano Homo sapiens Kanamycin PMID:30655515 Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Keratin V282L - please see depositor comments below 2026-08-15 01:04:35 2
pTubulin-miRFP670nano
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127429 miRFP670nano-human alpha-tubulin Homo sapiens Ampicillin PMID:30655515 Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:35 2
pActin-miRFP670nano
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_127428 miRFP670nano-human beta-actin Homo sapiens Ampicillin PMID:30655515 Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:35 1
pcDNA3.1/NDUFS2 _34-66/myc-His
 
Resource Report
Resource Website 		RRID:Addgene_127495 NDUFS2 _34-66 Homo sapiens Ampicillin PMID:34852219 Backbone Marker:Invitrogen ; Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin NDUFS2 _34-66 2026-08-15 01:04:36 0
pcDNA3.1/NDUFS2 H60A/myc-His
 
Resource Report
Resource Website 		RRID:Addgene_127499 NDUFS2 H60A Homo sapiens Ampicillin PMID:34852219 Backbone Marker:Invitrogen ; Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin NDUFS2 H60A 2026-08-15 01:04:36 0
pcDNA3.1/NDUFV2/myc-His
 
Resource Report
Resource Website 		RRID:Addgene_127491 NDUFV2 Homo sapiens Ampicillin PMID:34852219 Backbone Marker:Invitrogen ; Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:04:36 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch