Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pLentiCRISPR-v1-sgGPT2_9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163456 sgRNA 9 targeting GPT2 Homo sapiens Ampicillin PMID:33651980 Vector Backbone:pLentiCRISPR v1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 1
pLentiCRISPR-v1-sgMPC2_9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163458 sgRNA 9 targeting GPT2 Homo sapiens Ampicillin PMID:33651980 Vector Backbone:pLentiCRISPR v1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 2
pT-77
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16087 ull1 delta440 Saccharomyces cerevisiae Ampicillin PMID:12761287 Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:48 1
Phsp-16 cz::caspase-3 (p17) [TU#823]
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16086 cz :: caspase-3 (p17) Homo sapiens Ampicillin PMID:17283333 caspase-3 (p17) fused to the antiparallel leucine-zipper domain CZ (AQLEKKLQALEKKLAQLEWKNQALEKKLAQ). Backbone Marker:Andrew Fire Lab; Backbone Size:3914; Vector Backbone:pPD49.78; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:45 1
pAAV-FLEx-ER-TurboID
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_160857 ER TurboID Other Ampicillin PMID:33199915 Backbone Size:5700; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:08:45 1
pUC19_CRISPR_DpmrA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_160903 Cas9 Streptococcus thermophilus Bleocin (Zeocin) PMID:33113377 zeocin was cloned from the pCR2.1 topo gene from the invitrogen blunt topo plasmid Backbone Size:2686; Vector Backbone:pUC19; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:08:45 1
YIplac211-sGFP-Vrg4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_160904 VRG4 Saccharomyces cerevisiae Ampicillin PMID:30858194 Parental strain JK93da. Backbone Size:4000; Vector Backbone:YIplac211; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:45 1
pEF-ManII-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_160905 MAN2A1 Homo sapiens Ampicillin PMID:33112725 Backbone Size:5300; Vector Backbone:pEF/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:49 2
At2S3:RUBY
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_160906 RUBY and At2S3 promoter Synthetic Spectinomycin PMID:33024566 Backbone Size:9346; Vector Backbone:pHDE; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:08:45 1
pLV_Lyn11-mTurquoise2-iLID
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161000 Lyn11-mTurquoise2-iLID Synthetic Ampicillin PMID:33843200 Backbone Size:9240; Vector Backbone:pLenti 2nd gen; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:08:46 1
pLV_Stargazin-mTurquoise2-iLID
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161001 Stargazin-mTurquoise2-iLID Synthetic Ampicillin PMID:33843200 Backbone Size:9240; Vector Backbone:pLenti 2nd gen; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:08:50 4
pBScMXT-Shaw1a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16103 Voltage-gated K+ channel Caenorhabditis elegans Ampicillin PMID:8938713 Backbone Size:3200; Vector Backbone:pBScMXT; Vector Types:Xenopus Oocyte expression; Bacterial Resistance:Ampicillin 2026-08-15 01:08:47 1
pDONR221-SLC15A1_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161040 SLC15A1 Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131874 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:50 1
pDONR221-SLC16A9_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161042 SLC16A9 Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131876 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:47 1
pDONR221-DIRC2_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161046 DIRC2 Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131880 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:50 1
pDONR221-MFSD14B_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161047 MFSD14B Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131881 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:47 1
pDONR221-MFSD8_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161048 MFSD8 Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131882 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:47 1
modified pcAT7-Glo1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_160996 hemoglobin subunit beta Homo sapiens Ampicillin PMID:29859120 Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI. Backbone Size:5000; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Repeated intron 1 with 40 nucelotide deletion 2026-08-15 01:08:46 1
pDONR221-MFSD14A_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161035 MFSD14A Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131869 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:50 1
pDONR221-RHAG_STOP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_161037 RHAG Homo sapiens Kanamycin PMID:32265506 This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131871 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:08:47 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch