Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: psGFP(1-155)
Vector Backbone Description: Backbone Marker:Kodama and Wada 2009; Backbone Size:3459; Vector Backbone:pBRN169-MXMT; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_80170 Copy
Species: Synthetic
Genetic Insert: frGFP(1-155)
Vector Backbone Description: Backbone Marker:Kodama and Wada 2009; Backbone Size:3459; Vector Backbone:pBRN169-MXMT; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_80164 Copy
Species: Synthetic
Genetic Insert: sfGFP(1-155)
Vector Backbone Description: Backbone Marker:Kodama and Wada 2009; Backbone Size:3459; Vector Backbone:pBRN169-MXMT; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_80165 Copy
Species: Synthetic
Genetic Insert: QF2
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:3600; Vector Backbone:pHACK; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27334272
Proper citation: RRID:Addgene_80274 Copy
Species: Synthetic
Genetic Insert: GCaMP6f
Vector Backbone Description: Backbone Marker:Richard Mulligan; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27723744
Proper citation: RRID:Addgene_80315 Copy
Species: Synthetic
Genetic Insert: smURFP
Vector Backbone Description: Backbone Marker:Deisseroth / Boyden lab; Backbone Size:9436; Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27479328
Proper citation: RRID:Addgene_80348 Copy
Species: Synthetic
Genetic Insert: Tandem Dimer smURFP
Vector Backbone Description: Backbone Marker:Life Technlogies; Backbone Size:4740; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27479328
Proper citation: RRID:Addgene_80342 Copy
Species: Synthetic
Genetic Insert: AAVS1 TALEN (Left)
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26707206
Comments: Gateway assembled into a custom Gateway Entry vector using Addgene Kit #1000000024
Proper citation: RRID:Addgene_80495 Copy
Species: Synthetic
Genetic Insert: copGFP-T2A-Puromycine
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:pGreenPuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27189167
Proper citation: RRID:Addgene_80391 Copy
Species: Synthetic
Genetic Insert: EPN-01*
Vector Backbone Description: Backbone Marker:EMD Biosciences; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27919066
Proper citation: RRID:Addgene_80423 Copy
Species: Synthetic
Genetic Insert: copGFP-T2A-Luc2-F2A-Puromycin
Vector Backbone Description: Backbone Marker:SBI; Vector Backbone:pGreenPuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27189167
Proper citation: RRID:Addgene_80389 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Eyckerman lab; Backbone Size:4511; Vector Backbone:pMET7-GAG-HRAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27122307
Proper citation: RRID:Addgene_80605 Copy
Species: Synthetic
Genetic Insert: SYNZIP3
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80659 Copy
Species: Synthetic
Genetic Insert: SYNZIP2
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80658 Copy
Species: Synthetic
Genetic Insert: PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
Vector Backbone Description: Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28179459
Proper citation: RRID:Addgene_80767 Copy
Species: Synthetic
Genetic Insert: SYNZIP16
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80670 Copy
Species: Synthetic
Genetic Insert: SYNZIP22
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80676 Copy
Species: Synthetic
Genetic Insert: CRISPR gRNA expression cassette (for SpCas9)
Vector Backbone Description: Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27178736
Proper citation: RRID:Addgene_80792 Copy
Species: Synthetic
Genetic Insert: Monomeric streptavidin
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:5300; Vector Backbone:pET-IG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26979420
Proper citation: RRID:Addgene_80706 Copy
Species: Synthetic
Genetic Insert: SYNZIP7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2586; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22558529
Proper citation: RRID:Addgene_80663 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
