Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,517 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
35S-psGN155-MXMT-NosT
 
Resource Report
Resource Website 		RRID:Addgene_80170 psGFP(1-155) Synthetic Ampicillin Backbone Marker:Kodama and Wada 2009; Backbone Size:3459; Vector Backbone:pBRN169-MXMT; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:36 0
35S-frGN155-MXMT-NosT
 
Resource Report
Resource Website 		RRID:Addgene_80164 frGFP(1-155) Synthetic Ampicillin Backbone Marker:Kodama and Wada 2009; Backbone Size:3459; Vector Backbone:pBRN169-MXMT; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:36 0
35S-sfGN155-MXMT-NosT
 
Resource Report
Resource Website 		RRID:Addgene_80165 sfGFP(1-155) Synthetic Ampicillin Backbone Marker:Kodama and Wada 2009; Backbone Size:3459; Vector Backbone:pBRN169-MXMT; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:37 0
pHACK-QF2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80274 QF2 Synthetic Ampicillin PMID:27334272 Backbone Marker:DNA2.0; Backbone Size:3600; Vector Backbone:pHACK; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:38 4
pHAGE-RSV-GCAMP6f
 
Resource Report
Resource Website 		RRID:Addgene_80315 GCaMP6f Synthetic Ampicillin PMID:27723744 Backbone Marker:Richard Mulligan; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:20:38 0
pLenti-smURFP-T2A-mCardinal
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80348 smURFP Synthetic Ampicillin PMID:27479328 Backbone Marker:Deisseroth / Boyden lab; Backbone Size:9436; Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:20:38 1
pBAD-TDsmURFP-RBS-HO-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80342 Tandem Dimer smURFP Synthetic Ampicillin PMID:27479328 Backbone Marker:Life Technlogies; Backbone Size:4740; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:38 1
pTALdNC-AAVS1_T1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80495 AAVS1 TALEN (Left) Synthetic Kanamycin PMID:26707206 Gateway assembled into a custom Gateway Entry vector using Addgene Kit #1000000024 Backbone Size:2300; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:39 1
pBMN(CMV-copGFP-Puro-SMAR)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80391 copGFP-T2A-Puromycine Synthetic Ampicillin PMID:27189167 Backbone Marker:SBI; Vector Backbone:pGreenPuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:20:38 2
pET29b-EPN-01*
 
Resource Report
Resource Website 		RRID:Addgene_80423 EPN-01* Synthetic Kanamycin PMID:27919066 Backbone Marker:EMD Biosciences; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:39 0
pBMN(CMV-copGFP-Luc2-Puro)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_80389 copGFP-T2A-Luc2-F2A-Puromycin Synthetic Ampicillin PMID:27189167 Backbone Marker:SBI; Vector Backbone:pGreenPuro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:20:38 12
pMET7-GAG-EGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_80605 EGFP Synthetic Ampicillin PMID:27122307 Backbone Marker:Eyckerman lab; Backbone Size:4511; Vector Backbone:pMET7-GAG-HRAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:40 14
pQLinkHD-SYNZIP3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80659 SYNZIP3 Synthetic Ampicillin PMID:22558529 Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:40 1
pQLinkHD-SYNZIP2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80658 SYNZIP2 Synthetic Ampicillin PMID:22558529 Backbone Marker:Qiagen; Backbone Size:4892; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:20:41 1
pDonor-tBFP-NLS-Neo (Universal)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_80767 PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT) Synthetic Kanamycin PMID:28179459 Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 19
pENTR-SYNZIP16
 
Resource Report
Resource Website 		RRID:Addgene_80670 SYNZIP16 Synthetic Kanamycin PMID:22558529 Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pENTR-SYNZIP22
 
Resource Report
Resource Website 		RRID:Addgene_80676 SYNZIP22 Synthetic Kanamycin PMID:22558529 Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 0
pMA-SpCas9-g9
 
Resource Report
Resource Website 		RRID:Addgene_80792 CRISPR gRNA expression cassette (for SpCas9) Synthetic Ampicillin PMID:27178736 Backbone Marker:Lifetechnologies; Backbone Size:2380; Vector Backbone:pMA15; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:20:41 0
pET-IG-mSA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80706 Monomeric streptavidin Synthetic Kanamycin PMID:26979420 Backbone Marker:Homemade; Backbone Size:5300; Vector Backbone:pET-IG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:20:41 2
pENTR-SYNZIP7
 
Resource Report
Resource Website 		RRID:Addgene_80663 SYNZIP7 Synthetic Kanamycin PMID:22558529 Backbone Marker:Invitrogen; Backbone Size:2586; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:20:40 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch