Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pVC228 VEGF Site#3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47507 gRNA-VEGF site 3 Homo sapiens Ampicillin PMID:23792628 Target site: GGTGAGTGAGTGTGTGCGTG gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9) Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:42 3
pEGFP GR
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_47504 Glucocorticoid receptor Homo sapiens Kanamycin Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:42 13
LITE2.0_pAAV_hSyn_TALE(Grm2)-GS-CIB1(NLS*,∆318-334)_WPRE_bGHpA
 
Resource Report
Resource Website 		RRID:Addgene_47456 TALE(Grm2)-GS-CIB1(NLS*,∆318-334) Synthetic Ampicillin PMID:23877069 Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
LITE2.0 pAAV_hSyn_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47455 NLS(alpha-imp)-CRY2PHR-NLS-VP64 Synthetic Ampicillin PMID:23877069 Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 1
pAAV_hSyn_TALEBB(HD)-NLS-VP64_2A_GFP_WPRE_bGHpA
 
Resource Report
Resource Website 		RRID:Addgene_47446 TALE BB(N136_0.5HD_C63)-VP64 Synthetic Ampicillin PMID:23877069 Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
Flag-JunWT-Myc
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_47443 Jun Mus musculus Kanamycin PMID:21196933 Backbone Size:4300; Vector Backbone:pCMV-Tag2A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 14
pAAV_hSyn_TALEBB(NN)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA
 
Resource Report
Resource Website 		RRID:Addgene_47449 TALE BB(N136_0.5NN_C63)-SID4X Synthetic Ampicillin PMID:23877069 Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
pAAV_hSyn_TALEBB(NI)-NLS-VP64_2A_GFP_WPRE_bGHpA
 
Resource Report
Resource Website 		RRID:Addgene_47448 TALE BB(N136_0.5NI_C63)-VP64 Synthetic Ampicillin PMID:23877069 Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin 2026-08-15 01:15:42 0
pJ251-GERC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47441 Gene Expression Reporter Construct Synthetic Kanamycin Backbone Marker:DNA2.0; Backbone Size:2628; Vector Backbone:pJ251; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 8
pGEM-mcpGFP
 
Resource Report
Resource Website 		RRID:Addgene_47442 mcpGFP Synthetic Ampicillin PMID:23840931 same as Tian L, Hires SA, Mao T, Huber D, Chiappe ME, Chalasani SH, et al. 2009. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat Methods 6:875–81. doi: 10.1038/nmeth.1398. Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM T-easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin M154K, V164A, S176G, D181Y, T204V, A207K, V190I 2026-08-15 01:15:42 0
pLX302 Luciferase-V5 puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47553 Luciferase Firefly Ampicillin PMID:23921087 Backbone Marker:Addgene #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin None 2026-08-15 01:15:43 5
pCDNA_B2AR-s-pep
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47438 beta2-adrenergic receptor Homo sapiens Ampicillin PMID:23629648 Notes: (1) The pCDNA/FRT vector contains an extra XbaI site. (2) The XbaI restriction enzyme is sensitive to dam methylation. Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:42 2
pCDNA_B2AR-no-pep
 
Resource Report
Resource Website 		RRID:Addgene_47439 beta2-adrenergic receptor Homo sapiens Ampicillin PMID:23629648 Notes: (1) The pCDNA/FRT vector contains an extra XbaI site. (2) The XbaI restriction enzyme is sensitive to dam methylation. (3) No-pep sensor contains a short repeating GSG sequence at the C-terminus of mCerulean. Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
pCDNA_B2AR-q-pep
 
Resource Report
Resource Website 		RRID:Addgene_47437 beta2-adrenergic receptor Homo sapiens Ampicillin PMID:23629648 Notes: (1) The pCDNA/FRT vector contains an extra XbaI site. (2) The XbaI restriction enzyme is sensitive to dam methylation. Backbone Size:5070; Vector Backbone:pCDNA5_FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 0
Flag Intersectin Short (human)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47392 Intersectin short Homo sapiens Ampicillin PMID:11584276 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:41 1
Flag-Tagged Clavesin1 (pCMV-Tag2B-Sec14a)
 
Resource Report
Resource Website 		RRID:Addgene_47430 Clavesin1 Homo sapiens Kanamycin PMID:19651769 Backbone Marker:Stratagene; Backbone Size:4324; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 0
Intersectin SH3 domain C
 
Resource Report
Resource Website 		RRID:Addgene_47398 Intersectin SH3 domain C Other Ampicillin PMID:9813051 Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2t; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin SH3 domain C 2026-08-15 01:15:41 0
GFP-Intersectin Long
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47395 intersectin long Homo sapiens Kanamycin PMID:11584276 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:41 5
Intersectin SH3 domain A
 
Resource Report
Resource Website 		RRID:Addgene_47396 Intersectin SH3 domain A Other Ampicillin PMID:9813051 Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-2t; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin SH3 domain A 2026-08-15 01:15:42 0
pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47550 Cas9 Synthetic Ampicillin PMID:23995389 For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/ gRNA target sequence atatcagtctgtttcgtaa Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin Codon optimized and with synthetic introns for C. elegans 2026-08-15 01:15:43 9

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch