Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pJZC48
 
Resource Report
Resource Website
RRID:Addgene_62336 sgRNA + 1x COM binding module Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA 2026-08-15 01:17:52 0
pDSAT
 
Resource Report
Resource Website
RRID:Addgene_62290 Kanamycin PMID:25869647 Backbone Marker:Invitrogen; Backbone Size:5147; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:51 0
pDSAY
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62291 Kanamycin PMID:25869647 Backbone Marker:Invitrogen; Backbone Size:5147; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:51 2
pDSAR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62292 Kanamycin PMID:25869647 Backbone Marker:Invitrogen; Backbone Size:5103; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:51 1
pJZC33
 
Resource Report
Resource Website
RRID:Addgene_62330 sgRNA + 2x MS2 binding module Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA 2026-08-15 01:17:52 0
pENTR R4-vas2-integrase-R3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62299 phageC31 integrase under control of vasa promoter and terminator Streptomyces phage C31 Kanamycin PMID:25869647 Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:51 4
pBSKΔB-CAG-MCP-tdiRFP670-IRES-Neo
 
Resource Report
Resource Website
RRID:Addgene_62345 MCP-tdiRFP670 Synthetic Ampicillin PMID:26092696 Vector Backbone:pBlueScript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pBSKΔB- CAG-rtTA2sM2-IRES-tTSkid-IRES-Neo
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62346 rtTA2sM2-IRES-tTSkid Synthetic Ampicillin PMID:26092696 Vector Backbone:pBlueScript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 1
pJZC74
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62342 sgRNA + 1x COM binding module Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets sv40 promoter, sequence: GAATAGCTCAGAGGCCGAGG 2026-08-15 01:17:52 1
pJZC116
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62344 sgRNA + 2x MS2 (wt+f6) binding module Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGC 2026-08-15 01:17:52 1
pBoPyV2a-S22
 
Resource Report
Resource Website
RRID:Addgene_62356 Full genome of BoPyV2a isolate S22 Viruses (Polyomaviridae) Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with SacII Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:52 0
pJW1504
 
Resource Report
Resource Website
RRID:Addgene_62358 RPS2 fragment Saccharomyces cerevisiae Ampicillin PMID:25378630 Backbone Size:4373; Vector Backbone:pRS306; Vector Types:yeast targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pJW1505
 
Resource Report
Resource Website
RRID:Addgene_62359 RPL16A Saccharomyces cerevisiae Ampicillin PMID:25378630 Vector Backbone:pRS306; Vector Types:yeast tagging; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
p28BIOH-LIC
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62352 Kanamycin GenBank accession: EF442785 Backbone Marker:Structural Genomics Consortium; Backbone Size:7373; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:52 2
pTV-Oct4-TK-HMS
 
Resource Report
Resource Website
RRID:Addgene_62351 TK-Hyg-24xMS2 Mus musculus Ampicillin PMID:26092696 Backbone Size:6395; Vector Backbone:pBlueScript II SK (+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
MXS_mAzamiGreen
 
Resource Report
Resource Website
RRID:Addgene_62404 mAzamiGreen Synthetic Ampicillin PMID:25909630 Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pBoPyV3-S22
 
Resource Report
Resource Website
RRID:Addgene_62368 Full genome of BoPyV3 isolate S22 Viruses (Polyomaviridae) Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with EcoRI Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:52 0
MXS_Cerulean
 
Resource Report
Resource Website
RRID:Addgene_62401 Cerulean Synthetic Ampicillin PMID:25909630 Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pBoPyV3-S23
 
Resource Report
Resource Website
RRID:Addgene_62369 Full genome of BoPyV3 isolate S23 Viruses (Polyomaviridae) Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with EcoRI Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:17:52 0
pJW1511
 
Resource Report
Resource Website
RRID:Addgene_62365 Puro-T2A-AVITEVHAmmuRPL10A Mus musculus Ampicillin PMID:25378630 Vector Backbone:pMK1047; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.