Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 249 showing 4961 ~ 4980 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_49042

    This resource has 1+ mentions.

http://www.addgene.org/49042

Vector Backbone Description: Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013198

Proper citation: RRID:Addgene_49042 Copy   


  • RRID:Addgene_48993

    This resource has 1+ mentions.

http://www.addgene.org/48993

Genetic Insert: aminoglycoside 3' phosphotransferase
Vector Backbone Description: Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19432966
Comments: Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_48993 Copy   


  • RRID:Addgene_49048

    This resource has 1+ mentions.

http://www.addgene.org/49048

Species: Bos taurus
Genetic Insert: Enteropeptidase, peptidase domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24184090

Proper citation: RRID:Addgene_49048 Copy   


  • RRID:Addgene_48991

http://www.addgene.org/48991

Vector Backbone Description: Backbone Marker:Dankort lab, unpublished; Backbone Size:7435; Vector Backbone:gQxiPuro; Vector Types:Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24146852

Proper citation: RRID:Addgene_48991 Copy   


  • RRID:Addgene_49046

    This resource has 1+ mentions.

http://www.addgene.org/49046

Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Marker:DNA2.0; Vector Backbone:pJexpress609; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49046 Copy   


  • RRID:Addgene_49045

    This resource has 1+ mentions.

http://www.addgene.org/49045

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors: http://www.addgene.org/48240/ http://www.addgene.org/48239/ http://www.addgene.org/48238/ http://www.addgene.org/48236/ For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_49045 Copy   


http://www.addgene.org/48985

Species: Other
Genetic Insert: hygromycin phosphotransferase
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852

Proper citation: RRID:Addgene_48985 Copy   


  • RRID:Addgene_48983

http://www.addgene.org/48983

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4141-4174

Proper citation: RRID:Addgene_48983 Copy   


  • RRID:Addgene_48989

http://www.addgene.org/48989

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4131-4164

Proper citation: RRID:Addgene_48989 Copy   


  • RRID:Addgene_48988

http://www.addgene.org/48988

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4755-4788

Proper citation: RRID:Addgene_48988 Copy   


http://www.addgene.org/48987

Species: Other
Genetic Insert: puromycin resistance
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852
Comments: Please note that Addgene's sequencing results identified a few sequencing differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing lab, these differences are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_48987 Copy   


  • RRID:Addgene_49033

http://www.addgene.org/49033

Vector Backbone Description: Backbone Marker:Lorenz et al, 1996 (PubMed ID: 8917596); Backbone Size:5306; Vector Backbone:pTLN; Vector Types:Xenopus oocytes expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Iwan Zimmermann, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.

Proper citation: RRID:Addgene_49033 Copy   


  • RRID:Addgene_49031

    This resource has 1+ mentions.

http://www.addgene.org/49031

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6578; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.

Proper citation: RRID:Addgene_49031 Copy   


http://www.addgene.org/48982

Genetic Insert: blasticidin-S deaminase
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852

Proper citation: RRID:Addgene_48982 Copy   


  • RRID:Addgene_48981

http://www.addgene.org/48981

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4074-4107

Proper citation: RRID:Addgene_48981 Copy   


  • RRID:Addgene_48975

http://www.addgene.org/48975

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 3987-4020

Proper citation: RRID:Addgene_48975 Copy   


  • RRID:Addgene_48974

    This resource has 1+ mentions.

http://www.addgene.org/48974

Vector Backbone Description: Backbone Marker:Malcolm Moore lab; Vector Backbone:pUltra; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: AmCyan1 excitation and emission maxima are 458 and 489 nm, respectively

Proper citation: RRID:Addgene_48974 Copy   


  • RRID:Addgene_49028

http://www.addgene.org/49028

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5855; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.

Proper citation: RRID:Addgene_49028 Copy   


  • RRID:Addgene_48972

http://www.addgene.org/48972

Species: Synthetic
Genetic Insert: 3xFNLDD
Vector Backbone Description: Backbone Marker:Toshio Kitamura; Backbone Size:5994; Vector Backbone:pMXs-IG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25607658

Proper citation: RRID:Addgene_48972 Copy   


  • RRID:Addgene_49027

    This resource has 1+ mentions.

http://www.addgene.org/49027

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8362; Vector Backbone:pYES2/CT; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland. The ampicillin resistance cassette is located at bp# 4361-5221.

Proper citation: RRID:Addgene_49027 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X