Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
EMM65 Resource Report Resource Website 1+ mentions |
RRID:Addgene_49042 | Ampicillin | PMID:24013198 | Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:56 | 4 | ||||
|
pDONR221-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_48993 | aminoglycoside 3' phosphotransferase | Kanamycin | PMID:19432966 | Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid. | Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:56 | 1 | ||
|
pET-15b-EK_C122S_His5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_49048 | Enteropeptidase, peptidase domain | Bos taurus | Ampicillin | PMID:24184090 | Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | P92R, E185D, C122S | 2026-08-15 01:15:55 | 4 | |
|
pREG(R1-R4) #BGV059 Resource Report Resource Website |
RRID:Addgene_48991 | Chloramphenicol and Ampicillin | PMID:24146852 | Backbone Marker:Dankort lab, unpublished; Backbone Size:7435; Vector Backbone:gQxiPuro; Vector Types:Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:55 | 0 | ||||
|
pJ609 Flag-Sumo1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_49046 | SUMO1 | Homo sapiens | Ampicillin | Backbone Marker:DNA2.0; Vector Backbone:pJexpress609; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:55 | 1 | |||
|
pAC155-pCR8-sgExpression Resource Report Resource Website 1+ mentions |
RRID:Addgene_49045 | Spectinomycin | PMID:23979020 | Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors: http://www.addgene.org/48240/ http://www.addgene.org/48239/ http://www.addgene.org/48238/ http://www.addgene.org/48236/ For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:56 | 1 | |||
|
pBEG R2-iHygro-L3 #BGV206 Resource Report Resource Website |
RRID:Addgene_48985 | hygromycin phosphotransferase | Other | Kanamycin | PMID:24146852 | Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:55 | 0 | ||
|
pAW8ENdeI-spo5DSR Resource Report Resource Website |
RRID:Addgene_48983 | Ampicillin | PMID:24376751 | This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4141-4174 | Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:56 | 0 | |||
|
pAW8ENdeI-c3HA Resource Report Resource Website |
RRID:Addgene_48989 | Ampicillin | PMID:24376751 | This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4131-4164 | Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:55 | 0 | |||
|
pAW8ENdeI-cyEGFP Resource Report Resource Website |
RRID:Addgene_48988 | Ampicillin | PMID:24376751 | This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4755-4788 | Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:55 | 0 | |||
|
pBEG R2-iPuro-L3 #BGV205 Resource Report Resource Website |
RRID:Addgene_48987 | puromycin resistance | Other | Kanamycin | PMID:24146852 | Please note that Addgene's sequencing results identified a few sequencing differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing lab, these differences are not a concern for the function of the plasmid. | Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:56 | 0 | |
|
pTLNXA7 Resource Report Resource Website |
RRID:Addgene_49033 | Chloramphenicol and Ampicillin | PMID:21410291 | Constructed by Dr. Iwan Zimmermann, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland. | Backbone Marker:Lorenz et al, 1996 (PubMed ID: 8917596); Backbone Size:5306; Vector Backbone:pTLN; Vector Types:Xenopus oocytes expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:55 | 0 | |||
|
pcDXC3GMS Resource Report Resource Website 1+ mentions |
RRID:Addgene_49031 | Chloramphenicol and Ampicillin | PMID:21410291 | Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland. | Backbone Marker:Invitrogen; Backbone Size:6578; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:56 | 2 | |||
|
pBEG R2-iBlast-L3 #BGV204 Resource Report Resource Website |
RRID:Addgene_48982 | blasticidin-S deaminase | Kanamycin | PMID:24146852 | Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:55 | 0 | |||
|
pAW8ENdeI-8XDSR Resource Report Resource Website |
RRID:Addgene_48981 | Ampicillin | PMID:24376751 | This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4074-4107 | Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:55 | 0 | |||
|
pAW8ENdeI Resource Report Resource Website |
RRID:Addgene_48975 | Ampicillin | PMID:24376751 | This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 3987-4020 | Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:55 | 0 | |||
|
pUltra-Smurf Resource Report Resource Website 1+ mentions |
RRID:Addgene_48974 | Ampicillin | AmCyan1 excitation and emission maxima are 458 and 489 nm, respectively | Backbone Marker:Malcolm Moore lab; Vector Backbone:pUltra; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:56 | 4 | ||||
|
pcDXNSM3 Resource Report Resource Website |
RRID:Addgene_49028 | Chloramphenicol and Ampicillin | PMID:21410291 | Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland. | Backbone Marker:Invitrogen; Backbone Size:5855; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:56 | 0 | |||
|
3xFNLDD/pMXs-IG Resource Report Resource Website |
RRID:Addgene_48972 | 3xFNLDD | Synthetic | Ampicillin | PMID:25607658 | Backbone Marker:Toshio Kitamura; Backbone Size:5994; Vector Backbone:pMXs-IG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:55 | 0 | ||
|
pYEXC3GH Resource Report Resource Website 1+ mentions |
RRID:Addgene_49027 | Chloramphenicol and Ampicillin | PMID:21410291 | Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland. The ampicillin resistance cassette is located at bp# 4361-5221. | Backbone Marker:Invitrogen; Backbone Size:8362; Vector Backbone:pYES2/CT; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:55 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.