Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 249 showing 4961 ~ 4980 out of 33,857 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_31166

http://www.addgene.org/31166

Species: Homo sapiens
Genetic Insert: MEK
Vector Backbone Description: Backbone Size:2503; Vector Backbone:pME; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19269286
Comments: Middle entry clone.

Proper citation: RRID:Addgene_31166 Copy   


  • RRID:Addgene_31160

    This resource has 1+ mentions.

http://www.addgene.org/31160

Genetic Insert: chimeric fli1ep enhancer/promoter fragment
Vector Backbone Description: Backbone Size:2810; Vector Backbone:p5E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Comments: "p5E" refers to 5' entry clones flanked by L4-R1. Drives endothelial expression. See publication for more details: Dev Dyn. 2007 Nov . 236(11):3077-87 PMID: 17948311 https://www.ncbi.nlm.nih.gov/pubmed/17948311

Proper citation: RRID:Addgene_31160 Copy   


http://www.addgene.org/31152

Species: Homo sapiens
Genetic Insert: MITF-M
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-TAG4A; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19422606

Proper citation: RRID:Addgene_31152 Copy   


http://www.addgene.org/31154

Species: Homo sapiens
Genetic Insert: MITF-M
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-TAG4A; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19422606

Proper citation: RRID:Addgene_31154 Copy   


  • RRID:Addgene_31158

http://www.addgene.org/31158

Genetic Insert: basal adenovirus E1b TATA element
Vector Backbone Description: Backbone Size:2810; Vector Backbone:p5E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: "p5E" refers to 5' entry clones flanked by L4-R1

Proper citation: RRID:Addgene_31158 Copy   


  • RRID:Addgene_31151

    This resource has 1+ mentions.

http://www.addgene.org/31151

Species: Homo sapiens
Genetic Insert: MITF-M
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-TAG4A; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19422606

Proper citation: RRID:Addgene_31151 Copy   


  • RRID:Addgene_31227

    This resource has 1+ mentions.

http://www.addgene.org/31227

Species: Homo sapiens
Genetic Insert: TPX2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20110350

Proper citation: RRID:Addgene_31227 Copy   


  • RRID:Addgene_31226

    This resource has 1+ mentions.

http://www.addgene.org/31226

Species: Homo sapiens
Genetic Insert: TPX2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pPAGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20110350

Proper citation: RRID:Addgene_31226 Copy   


  • RRID:Addgene_31178

http://www.addgene.org/31178

Species: Xanthomonas
Genetic Insert: Monomer-NK
Vector Backbone Description: Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_31178 Copy   


  • RRID:Addgene_31274

    This resource has 1+ mentions.

http://www.addgene.org/31274

Species: E. coli
Genetic Insert: RecG-EGFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3992; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23110454

Proper citation: RRID:Addgene_31274 Copy   


  • RRID:Addgene_31275

    This resource has 1+ mentions.

http://www.addgene.org/31275

Species: E. coli
Genetic Insert: RecG-ST2-TaV-EGFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3992; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23110454

Proper citation: RRID:Addgene_31275 Copy   


  • RRID:Addgene_31305

    This resource has 1+ mentions.

http://www.addgene.org/31305

Species: Homo sapiens
Genetic Insert: Mesothelin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21505261
Comments: Msln Promoter sequence provided by author (see above link) Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid. Msln-1F: TCATTTGTTCCCTTTGACGGC Msln-1R: CTCTCCCCAGCATCCACATTC Expect 987 nt product Msln-2F: TTGCCTACAACACCCTGCTGCG Msln-2R: GCTCACAATGCTTCCATCAAACG Expect 792 nt product

Proper citation: RRID:Addgene_31305 Copy   


  • RRID:Addgene_31375

    This resource has 1+ mentions.

http://www.addgene.org/31375

Genetic Insert: rtTA-IRES-BirA
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20890903

Proper citation: RRID:Addgene_31375 Copy   


  • RRID:Addgene_31636

http://www.addgene.org/31636

Species: Oryctolagus cuniculus
Genetic Insert: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17895247
Comments: pEGF-RN1.seq Make by SS's lab Randy HAll's HA-RN1 cut with ECOR1 & XHO1 pEGFP-C2.seq cut with ECOR1 & SAL1 ligated. eGFP translation starts @ 613 rN1@ 1375

Proper citation: RRID:Addgene_31636 Copy   


  • RRID:Addgene_31605

http://www.addgene.org/31605

Species: Mus musculus
Genetic Insert: kinesin-1C
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4001; Vector Backbone:pEGFP-C1 (EGFP removed); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31605 Copy   


  • RRID:Addgene_31607

    This resource has 1+ mentions.

http://www.addgene.org/31607

Species: Mus musculus
Genetic Insert: kinesin-1A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3940; Vector Backbone:pEGFP-C1 (EGFP removed); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31607 Copy   


  • RRID:Addgene_31803

    This resource has 1+ mentions.

http://www.addgene.org/31803

Species: Homo sapiens
Genetic Insert: Rab8a
Vector Backbone Description: Vector Backbone:P643_pmEGFP_N_dest.; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21310966

Proper citation: RRID:Addgene_31803 Copy   


  • RRID:Addgene_31871

    This resource has 1+ mentions.

http://www.addgene.org/31871

Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31871 Copy   


  • RRID:Addgene_31867

    This resource has 1+ mentions.

http://www.addgene.org/31867

Genetic Insert: LSS-mKate2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3998; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31867 Copy   


  • RRID:Addgene_31869

    This resource has 1+ mentions.

http://www.addgene.org/31869

Genetic Insert: LSS-mKate2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3983; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31869 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X