Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: CAMKIIalpha
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9768845
Proper citation: RRID:Addgene_21226 Copy
Species: Rattus norvegicus
Genetic Insert: CaMKIIbeta(A303R)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10102820
Proper citation: RRID:Addgene_21224 Copy
Species: Rattus norvegicus
Genetic Insert: ROMK1
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:10000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10938328
Proper citation: RRID:Addgene_21322 Copy
Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-1
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT
Proper citation: RRID:Addgene_21621 Copy
Species: Rattus norvegicus
Genetic Insert: Gene33
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10749885
Comments: Plasmid was also used in Xu et al. 2005
the construct can be used in cardiomyocytes
There is a V to L amino acid change at position 6. The lab feels it is conservative enough not to matter.
Proper citation: RRID:Addgene_21633 Copy
Species: Rattus norvegicus
Genetic Insert: mTOR (1271-2008)
Vector Backbone Description: Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12718876
Proper citation: RRID:Addgene_21746 Copy
Species: Rattus norvegicus
Genetic Insert: Genetic suppressor element #22, T329A
Vector Backbone Description: Backbone Size:8712; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Encodes amino acids #312-391 of rat p53 to act as a dominant-negative
(Ossovskaya et al. 1996, PNAS 93:10309-10314).
T329A mutation does not prevent tetramerization of p53
(Mateu et al. Nat Struct Biol. 1999 Feb;6(2):191-8).
Proper citation: RRID:Addgene_22255 Copy
Species: Rattus norvegicus
Genetic Insert: Epsin 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9723620
Comments: Please note: Addgene's quality control sequence found the EPSIN1 gene has an insertion of threonine after aa 821 and since there is no stop codon, ESPIN1 contains the additional c terminal residues VDGTAGPGSTGSR. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_22228 Copy
Species: Rattus norvegicus
Genetic Insert: ATP-gated P2X channel 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16033901
Proper citation: RRID:Addgene_22400 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:3600; Vector Backbone:RSV-SG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2573431
Comments: insert can be released by digesting with HindIII/Xba1
Proper citation: RRID:Addgene_22394 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:3600; Vector Backbone:RSV-SG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2573431
Proper citation: RRID:Addgene_22395 Copy
Species: Rattus norvegicus
Genetic Insert: microtubule-associated protein 1 light chain 3 beta
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18094039
Comments: LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8.
Proper citation: RRID:Addgene_22405 Copy
Species: Rattus norvegicus
Genetic Insert: PAM2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCIS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1577852
Proper citation: RRID:Addgene_25457 Copy
Species: Rattus norvegicus
Genetic Insert: Kal9
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEAK-His-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10777487
Comments: There are 2 mutations in the sequence, T46S and N62Y. These sequencing errors are the result of mistakes in initial submission to GenBank by the depositing lab. The sequence should be correct.
Proper citation: RRID:Addgene_25441 Copy
Species: Rattus norvegicus
Genetic Insert: Nav1.2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20543823
Proper citation: RRID:Addgene_26056 Copy
Species: Rattus norvegicus
Genetic Insert: mammalian target of rapamycin-R2505P
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20190810
Proper citation: RRID:Addgene_26038 Copy
Species: Rattus norvegicus
Genetic Insert: mammalian target of rapamycin-S2215Y
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20190810
Proper citation: RRID:Addgene_26037 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptophysin GCaMP2
Vector Backbone Description: Backbone Size:3957; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19898484
Comments: ORF frame 3 (624-2915): Rat SyGCaMP2.
Our sequence with CMV-F shows a mutation S199T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.
Proper citation: RRID:Addgene_26124 Copy
Species: Rattus norvegicus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Backbone Size:9322; Vector Backbone:pORANGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32275651
Proper citation: RRID:Addgene_131486 Copy
Species: Rattus norvegicus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Backbone Size:9261; Vector Backbone:pORANGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32275651
Proper citation: RRID:Addgene_131482 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.