Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 25 showing 481 ~ 500 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_52255

    This resource has 1+ mentions.

http://www.addgene.org/52255

Species: Arabidopsis thaliana
Genetic Insert: guide RNA targeting AtPDS3
Vector Backbone Description: Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23929339
Comments: gRNA target sequence GGACTTTTGCCAGCCATGGT This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.

Proper citation: RRID:Addgene_52255 Copy   


  • RRID:Addgene_52252

http://www.addgene.org/52252

Species: Drosophila melanogaster
Genetic Insert: Mtl
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_52252 Copy   


  • RRID:Addgene_52250

http://www.addgene.org/52250

Species: Drosophila melanogaster
Genetic Insert: Cdc42
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Comments: Please note that the ORF contains a SNP at A172T.

Proper citation: RRID:Addgene_52250 Copy   


  • RRID:Addgene_52258

    This resource has 1+ mentions.

http://www.addgene.org/52258

Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52258 Copy   


  • RRID:Addgene_52267

http://www.addgene.org/52267

Species: Mus musculus
Genetic Insert: TDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52267 Copy   


  • RRID:Addgene_52268

http://www.addgene.org/52268

Species: Mus musculus
Genetic Insert: TDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52268 Copy   


  • RRID:Addgene_52263

http://www.addgene.org/52263

Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52263 Copy   


  • RRID:Addgene_52261

http://www.addgene.org/52261

Species: Homo sapiens
Genetic Insert: SUMO-1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52261 Copy   


  • RRID:Addgene_52271

http://www.addgene.org/52271

Species: Homo sapiens
Genetic Insert: hTDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52271 Copy   


  • RRID:Addgene_52276

http://www.addgene.org/52276

Species: Homo sapiens
Genetic Insert: XRCC1
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52276 Copy   


  • RRID:Addgene_52275

http://www.addgene.org/52275

Species: Homo sapiens
Genetic Insert: XRCC1
Vector Backbone Description: Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4983; Vector Backbone:pGEX-6P-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52275 Copy   


  • RRID:Addgene_52273

http://www.addgene.org/52273

Species: Homo sapiens
Genetic Insert: hTDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52273 Copy   


  • RRID:Addgene_52281

http://www.addgene.org/52281

Species: Homo sapiens
Genetic Insert: hTDG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52281 Copy   


  • RRID:Addgene_52280

http://www.addgene.org/52280

Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52280 Copy   


  • RRID:Addgene_52289

http://www.addgene.org/52289

Species: Drosophila melanogaster
Genetic Insert: Non-stop
Vector Backbone Description: Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24493646

Proper citation: RRID:Addgene_52289 Copy   


http://www.addgene.org/52287

Species: Drosophila melanogaster
Genetic Insert: Sgf11
Vector Backbone Description: Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24493646

Proper citation: RRID:Addgene_52287 Copy   


  • RRID:Addgene_52288

http://www.addgene.org/52288

Species: Drosophila melanogaster
Genetic Insert: E(y)2
Vector Backbone Description: Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24493646

Proper citation: RRID:Addgene_52288 Copy   


  • RRID:Addgene_52286

http://www.addgene.org/52286

Species: Drosophila melanogaster
Genetic Insert: Ataxin-7
Vector Backbone Description: Backbone Size:3991; Vector Backbone:pRmHA3; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24493646

Proper citation: RRID:Addgene_52286 Copy   


  • RRID:Addgene_52283

http://www.addgene.org/52283

Species: Homo sapiens
Genetic Insert: XRCC1
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25007328

Proper citation: RRID:Addgene_52283 Copy   


  • RRID:Addgene_52179

    This resource has 1+ mentions.

http://www.addgene.org/52179

Species: Homo sapiens
Genetic Insert: F2
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25713122
Comments: Article ref 161

Proper citation: RRID:Addgene_52179 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X