Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 25 showing 481 ~ 500 out of 1,658 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_32191

    This resource has 1+ mentions.

http://www.addgene.org/32191

Genetic Insert: TALE Nuclease, NN for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791

Proper citation: RRID:Addgene_32191 Copy   


  • RRID:Addgene_32192

    This resource has 1+ mentions.

http://www.addgene.org/32192

Genetic Insert: TALE Nuclease, HD for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791

Proper citation: RRID:Addgene_32192 Copy   


  • RRID:Addgene_32188

    This resource has 1+ mentions.

http://www.addgene.org/32188

Genetic Insert: TALE Transcriptional Activator Backbone, HD for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791

Proper citation: RRID:Addgene_32188 Copy   


  • RRID:Addgene_32189

    This resource has 1+ mentions.

http://www.addgene.org/32189

Genetic Insert: TALE Nuclease, NI for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791

Proper citation: RRID:Addgene_32189 Copy   


  • RRID:Addgene_32186

    This resource has 1+ mentions.

http://www.addgene.org/32186

Genetic Insert: TALE Transcriptional Activator Backbone, NG for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791

Proper citation: RRID:Addgene_32186 Copy   


  • RRID:Addgene_32317

http://www.addgene.org/32317

Genetic Insert: ccdB
Vector Backbone Description: Vector Backbone:pBSC5; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12784 for additional plasmid map.

Proper citation: RRID:Addgene_32317 Copy   


  • RRID:Addgene_32485

    This resource has 10+ mentions.

http://www.addgene.org/32485

Vector Backbone Description: Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18930792

Proper citation: RRID:Addgene_32485 Copy   


  • RRID:Addgene_32683

http://www.addgene.org/32683

Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21418658
Comments: The full plasmid sequence was assembled and may contain minor discrepancies that should not effect the function of the plasmid.

Proper citation: RRID:Addgene_32683 Copy   


  • RRID:Addgene_30325

http://www.addgene.org/30325

Species: phage phiC31
Genetic Insert: phiC31 attB site
Vector Backbone Description: Backbone Size:4670; Vector Backbone:pDEST; Vector Types:Drosophila transgenesis; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector with phiC31 attB site, for Drosophila transformation into attP landing sites.

Proper citation: RRID:Addgene_30325 Copy   


  • RRID:Addgene_188444

http://www.addgene.org/188444

Species: Synthetic
Genetic Insert: REL2N91/ccdB
Vector Backbone Description: Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32123041

Proper citation: RRID:Addgene_188444 Copy   


  • RRID:Addgene_188701

    This resource has 1+ mentions.

http://www.addgene.org/188701

Vector Backbone Description: Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:26445458

Proper citation: RRID:Addgene_188701 Copy   


  • RRID:Addgene_188887

http://www.addgene.org/188887

Vector Backbone Description: Vector Backbone:pDEST-P4-P3; Vector Types:Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34748534

Proper citation: RRID:Addgene_188887 Copy   


  • RRID:Addgene_186370

http://www.addgene.org/186370

Vector Backbone Description: Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites.

Proper citation: RRID:Addgene_186370 Copy   


http://www.addgene.org/186383

Vector Backbone Description: Backbone Size:5577; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mScarlet-I tag at Bgl II/Stu I restriction site

Proper citation: RRID:Addgene_186383 Copy   


http://www.addgene.org/186389

Vector Backbone Description: Backbone Size:5583; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mClover3 tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186389 Copy   


http://www.addgene.org/186386

Vector Backbone Description: Backbone Size:5796; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal emiRFP703 tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186386 Copy   


http://www.addgene.org/186385

Vector Backbone Description: Backbone Size:5427; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal Snap-tag tag at Bgl II/Stu I restriction site

Proper citation: RRID:Addgene_186385 Copy   


http://www.addgene.org/186384

Vector Backbone Description: Backbone Size:5598; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mVenus tag at Bgl II/Stu I restriction site

Proper citation: RRID:Addgene_186384 Copy   


http://www.addgene.org/186392

Vector Backbone Description: Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186392 Copy   


http://www.addgene.org/186390

Vector Backbone Description: Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site

Proper citation: RRID:Addgene_186390 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X