Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Gallus gallus
Genetic Insert: BMP4
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7553857
Comments: To make an antisense probe, cut with BamHI and transcribe with T3.
Proper citation: RRID:Addgene_16285 Copy
Species: Gallus gallus
Genetic Insert: Mutated Gallus gallus vinculin (G454V)
Vector Backbone Description: Vector Backbone:destination vector pDestTol2pA2(#394); Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: The incorporation of GgVCL and GgVCL/*TBM in a eukaryotic transient expression vector was done according to the following steps:
1) amplification of VCL sequence with Phusion-HF DNA pol and primers with a Kozac initiation sequence or RBS and side restriction enzyme
sites (KpnI -FW and EcoRI –rev; ch-VCL custom primers);
2) extension with Taq DNA pol to generate A-ends;
3) Ligation to the T-ended vector TOPO TA #450640 through the topo cloning reaction and dilution in TE (Invitrogen 8019005?);
4) transformation of DH5α (C2987I) and selection with kanamycin and IPTG/Xgal (EU 0012-D);
5) Minipreps (740588.250) from presumed 3 TOPO-WT and 3 TOPO-MUT colonies, DNA quantification and diagnostic digestions with AccI,
EcoRI or KpnI;
6) electrophoresis of abundant EcoRI + KpnI digestion products and band cutting;
7) purification of VCL sequence from gel and of EcoRI + KpnI digested and alkaline phosphatase (#EF0651) -treated pME-MCS (#237) with
Macherey-Nagel #740609.250 kit;
8) DNA quantification;
9) ligation of each VCL sequence to pME-MCS plasmid using Ligase T4 (NEB MO202T);
10) transformation of DH5α (NEB C2987I) with the respective ligation reactions; minipreps (740588.250) to obtain pME-VCL, DNA quantification
and diagnostic digestions with AccI , (KpnI-HF + EcoRI-HF) and BamHI-HF;
11) Tol2 kit LR reaction (Kwan et al 2007, DOI: 10.1002/dvdy.21343,) . Although the kit is originally aimed at zebrafish, it had already been assayed in mammalian cells.
The LR reaction involved the use of Gateway LR Clonase II Plus Enzyme Mix (Invitrogen 12538-120) to fuse 4 plasmids in one: the 5’entry
plasmid with a β-actin promoter called p5E-actin (#299), the middle entry plasmid with the VCL insert pME-VCL (wt or mut), the 3’entry plasmid
p3E-IRES-nls-GFP (#391) and the destination vector pDestTol2pA2 (#394). The expected LR reaction product is a 14,5 KB eukaryotic
expression vector which can be amplified in bacteria.
NEB C3019I bacteria were transformed with the LR reaction product. Three ampicillin-resistant clear colonies of each (β-actin- wt or mutVCLIRES
nclGFP) were chosen and amplified. Minipreps, DNA quantification and diagnostic digestions with (KpnI+AccI) and Pvu-IIHF were carried.
Finally, 200 mL of liquid culture were used to prepare MIDIPREPS (XXX). About 180 μg good quality DNA of each (Tol2-GgVCL or Tol2-
GgVCL/*TBM) expression vectors were obtained and checked by digestion with restriction enzymes.
Proper citation: RRID:Addgene_162790 Copy
Species: Gallus gallus
Genetic Insert: PEA3
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9814709
Comments: To make an antisense probe, cut with NotI and transcribe with T7.
Proper citation: RRID:Addgene_16279 Copy
Species: Gallus gallus
Genetic Insert: Gallus gallus vinculin
Vector Backbone Description: Vector Backbone:destination vector pDestTol2pA2(#394); Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: The incorporation of GgVCL and GgVCL/*TBM in a eukaryotic transient expression vector was done according to the following steps:
1) amplification of VCL sequence with Phusion-HF DNA pol and primers with a Kozac initiation sequence or RBS and side restriction enzyme sites (KpnI -FW and EcoRI –rev; ch-VCL custom primers);
2) extension with Taq DNA pol to generate A-ends;
3) Ligation to the T-ended vector TOPO TA #450640 through the topo cloning reaction and dilution in TE (Invitrogen 8019005?);
4) transformation of DH5α (C2987I) and selection with kanamycin and IPTG/Xgal (EU 0012-D);
5) Minipreps (740588.250) from presumed 3 TOPO-WT and 3 TOPO-MUT colonies, DNA quantification and diagnostic digestions with AccI, EcoRI or KpnI;
6) electrophoresis of abundant EcoRI + KpnI digestion products and band cutting;
7) purification of VCL sequence from gel and of EcoRI + KpnI digested and alkaline phosphatase (#EF0651) -treated pME-MCS (#237) with Macherey-Nagel #740609.250 kit;
8) DNA quantification;
9) ligation of each VCL sequence to pME-MCS plasmid using Ligase T4 (NEB MO202T);
10) transformation of DH5α (NEB C2987I) with the respective ligation reactions; minipreps (740588.250) to obtain pME-VCL, DNA quantification and diagnostic digestions with AccI , (KpnI-HF + EcoRI-HF) and BamHI-HF;
11) Tol2 kit LR reaction (Kwan et al 2007, DOI: 10.1002/dvdy.21343, ). Although the kit is originally aimed at zebrafish, it had already been assayed in mammalian cells. The LR reaction involved the use of Gateway LR Clonase II Plus Enzyme Mix (Invitrogen 12538-120) to fuse 4 plasmids in one: the 5’entry plasmid with a β-actin promoter called p5E-actin (#299), the middle entry plasmid with the VCL insert pME-VCL (wt or mut), the 3’entry plasmid p3E-IRES-nls-GFP (#391) and the destination vector pDestTol2pA2 (#394). The expected LR reaction product is a 14,5 KB eukaryotic expression vector which can be amplified in bacteria.
NEB C3019I bacteria were transformed with the LR reaction product. Three ampicillin-resistant clear colonies of each (β-actin- wt or mutVCL- IRES nclGFP) were chosen and amplified. Minipreps, DNA quantification and diagnostic digestions with (KpnI+AccI) and Pvu-IIHF were carried. Finally, 200 mL of liquid culture were used to prepare MIDIPREPS (XXX). About 180 µg good quality DNA of each (Tol2-GgVCL or Tol2-GgVCL/*TBM) expression vectors were obtained and checked by digestion with restriction enzymes.
Proper citation: RRID:Addgene_162787 Copy
Species: Gallus gallus
Genetic Insert: c-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2582237
Comments: pMcsrc was constructed by gel purifying the 8.1-kilobase (kb) BamHI c-src fragment running from c-src coordinates -2.1 to 6.0 kb and ligating it into plasmid pEVX which had been linearized at a unique BglII site lying between the two Moloney murine leukemia virus (MoMLV) long terminal
repeats (LTRs). The upstream BamHI site is about 270 base
pairs (bp) upstream from the beginning of c-src exon no. 2, whereas the downstream site lies about 1.2 kb beyond the c-src termination codon.
Proper citation: RRID:Addgene_17672 Copy
Species: Gallus gallus
Genetic Insert: c-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: The plasmid contains a c-src gene that encodes normal chicken pp60 c-src flanked by MoMLV LTRs from expression vector pEVX.
Proper citation: RRID:Addgene_17674 Copy
Species: Gallus gallus
Genetic Insert: c-src Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17675 Copy
Species: Gallus gallus
Genetic Insert: c-src Y416F Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3103925
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17677 Copy
Species: Gallus gallus
Genetic Insert: c-src S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474754
Comments: pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCCGCCCGGGA between the BamHI (codon 10) and BstNI (codon 18) sites of pcAlal2.
Proper citation: RRID:Addgene_17681 Copy
Species: Gallus gallus
Genetic Insert: NgCAM
Vector Backbone Description: Vector Backbone:pBa-SBP-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34731031
Comments: Please note: Plasmid contains A490T and K609E mutations in NgCAM compared to the depositor's provided sequence. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_180247 Copy
Species: Gallus gallus
Genetic Insert: SEMA4D
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:2900; Vector Backbone:pBLUESCRIPT (SK); Vector Types:pBlue for ISH; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29568 Copy
Species: Gallus gallus
Genetic Insert: cytoplasmic ovalbumin
Vector Backbone Description: Backbone Marker:Addgene #1765; Vector Backbone:pBabe-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32376951
Comments: Please note Addgene NGS found a few discrepancies in the gag (truncated) region but depositor has confirmed this does not affect plasmid function. Depositor has verified plasmid's capacity to over-express the expected gene in target cells.
Proper citation: RRID:Addgene_161737 Copy
Species: Gallus gallus
Genetic Insert: cytoplasmic ovalbumin
Vector Backbone Description: Backbone Marker:Addgene #1766; Vector Backbone:pBabe-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32376951
Proper citation: RRID:Addgene_161736 Copy
Species: Gallus gallus
Genetic Insert: TVA
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pMCS5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34099488
Proper citation: RRID:Addgene_164487 Copy
Species: Gallus gallus
Genetic Insert: Sema3A
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAG-NT; Vector Types:; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_16428 Copy
Species: Gallus gallus
Genetic Insert: capping protein alpha 1 (deletion 28 amino acids) beta 1 (deletion 34 amino acids)
Vector Backbone Description: Backbone Marker:novagen; Backbone Size:5000; Vector Backbone:pET- 3d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12956956
Comments: Soeno et al., 1998
Proper citation: RRID:Addgene_13301 Copy
Species: Gallus gallus
Genetic Insert: Clover-mRuby2-based vinculin tension sensor with (GGSGGS)5 extensible domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5399; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30024378
Comments: Partially based on Addgene Plasmids #26019, #49089, and #21769
Proper citation: RRID:Addgene_111763 Copy
Species: Gallus gallus
Genetic Insert: Clover-mRuby2-based vinculin tension sensor with (GGSGGS)9 extensible domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5399; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30024378
Comments: Partially based on Addgene Plasmids #26019, #49089, and #21769
Proper citation: RRID:Addgene_111765 Copy
Species: Gallus gallus
Genetic Insert: VinculinTS (A50I)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5402; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29642037
Proper citation: RRID:Addgene_111827 Copy
Species: Gallus gallus
Genetic Insert: VinculinTS (I997A)
Vector Backbone Description: Backbone Size:6235; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29642037
Proper citation: RRID:Addgene_111832 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
