Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:chloramphenicol and ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,658 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pTALEN_v2 (NN)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_32191 TALE Nuclease, NN for 0.5 repeat Chloramphenicol and Ampicillin PMID:22222791 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:39 2
pTALEN_v2 (HD)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_32192 TALE Nuclease, HD for 0.5 repeat Chloramphenicol and Ampicillin PMID:22222791 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:39 2
pTALETF_v2 (HD)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_32188 TALE Transcriptional Activator Backbone, HD for 0.5 repeat Chloramphenicol and Ampicillin PMID:22222791 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:39 3
pTALEN_v2 (NI)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_32189 TALE Nuclease, NI for 0.5 repeat Chloramphenicol and Ampicillin PMID:22222791 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:39 3
pTALETF_v2 (NG)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_32186 TALE Transcriptional Activator Backbone, NG for 0.5 repeat Chloramphenicol and Ampicillin PMID:22222791 Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:39 1
pDESThaw
 
Resource Report
Resource Website
RRID:Addgene_32317 ccdB Chloramphenicol and Ampicillin PMID:21931740 Please see http://www.everyvector.com/sequences/show_public/12784 for additional plasmid map. Vector Backbone:pBSC5; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:45 0
pSpliceExpress
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_32485 Chloramphenicol and Ampicillin PMID:18930792 Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:41 16
pLKO.DEST.YFP
 
Resource Report
Resource Website
RRID:Addgene_32683 Chloramphenicol and Ampicillin PMID:21418658 The full plasmid sequence was assembled and may contain minor discrepancies that should not effect the function of the plasmid. Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:43 0
pDEST-attB
 
Resource Report
Resource Website
RRID:Addgene_30325 phiC31 attB site phage phiC31 Chloramphenicol and Ampicillin Gateway destination vector with phiC31 attB site, for Drosophila transformation into attP landing sites. Backbone Size:4670; Vector Backbone:pDEST; Vector Types:Drosophila transgenesis; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:13:27 0
pGP4G-REL2N91-ccdB
 
Resource Report
Resource Website
RRID:Addgene_188444 REL2N91/ccdB Synthetic Chloramphenicol and Ampicillin PMID:32123041 Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:38 0
pDEST tol2 UbB polyA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_188701 Chloramphenicol and Ampicillin PMID:26445458 Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:39 1
pMLS715
 
Resource Report
Resource Website
RRID:Addgene_188887 Chloramphenicol and Ampicillin PMID:34748534 Vector Backbone:pDEST-P4-P3; Vector Types:Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:39 0
pDEST-Spe3-RfA
 
Resource Report
Resource Website
RRID:Addgene_186370 Chloramphenicol and Ampicillin PMID:17878951 Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites. Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:51 0
pDEST-Spe4-Kozak-mScarlet-I-RfA
 
Resource Report
Resource Website
RRID:Addgene_186383 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mScarlet-I tag at Bgl II/Stu I restriction site Backbone Size:5577; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:53 0
pDEST-Spe4-RfA-mClover3-stop
 
Resource Report
Resource Website
RRID:Addgene_186389 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mClover3 tag at EcoR V/Avr II restriction site Backbone Size:5583; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:53 0
pDEST-Spe4-RfA-emiRFP703-stop
 
Resource Report
Resource Website
RRID:Addgene_186386 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal emiRFP703 tag at EcoR V/Avr II restriction site Backbone Size:5796; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:53 0
pDEST-Spe4-Kozak-Snaptag-RfA
 
Resource Report
Resource Website
RRID:Addgene_186385 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal Snap-tag tag at Bgl II/Stu I restriction site Backbone Size:5427; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:56 0
pDEST-Spe4-Kozak-mVenus-RfA
 
Resource Report
Resource Website
RRID:Addgene_186384 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mVenus tag at Bgl II/Stu I restriction site Backbone Size:5598; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:53 0
pDEST-Spe4-RfA-mNeonGreen-stop
 
Resource Report
Resource Website
RRID:Addgene_186392 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:54 0
pDEST-Spe4-RfA-mEos4b-stop
 
Resource Report
Resource Website
RRID:Addgene_186390 Chloramphenicol and Ampicillin Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:23:53 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.