Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: mitochondrial antiviral signaling protein
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22427742
Proper citation: RRID:Addgene_45905 Copy
Species: Homo sapiens
Genetic Insert: ZAP(S) isoform
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18225958
Comments: Contains a M202T and L388F amino acid change in the insert, not known to effect function.
Proper citation: RRID:Addgene_45906 Copy
Species: Mus musculus
Genetic Insert: Zfp536
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45845 Copy
Species: Mus musculus
Genetic Insert: VE-cadherin Tension Sensor
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Proper citation: RRID:Addgene_45848 Copy
Species: Mus musculus
Genetic Insert: VE-cadherin
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Proper citation: RRID:Addgene_45849 Copy
Species: Mus musculus
Genetic Insert: Olig2
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45844 Copy
Species: Mus musculus
Genetic Insert: Sox10
Vector Backbone Description: Backbone Size:8377; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45843 Copy
Species: Lambda phage
Genetic Insert: gamS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/His A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24303785
Proper citation: RRID:Addgene_45833 Copy
Genetic Insert: miR125b sponge
Vector Backbone Description: Vector Backbone:MSCV EGFP (MG vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22366319
Proper citation: RRID:Addgene_45790 Copy
Genetic Insert: deGFP
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45789 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45780 Copy
Species: Homo sapiens
Genetic Insert: FOXO1
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBabe N-terminal RFP neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Proper citation: RRID:Addgene_45813 Copy
Species: Mus musculus
Genetic Insert: Runx1
Vector Backbone Description: Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Comments: pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse).
The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated.
Proper citation: RRID:Addgene_45815 Copy
Species: Homo sapiens
Genetic Insert: FOXO1
Vector Backbone Description: Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Comments: pBabe DN-FOXO1-HA-neo was constructed by PCR using a pBabe FOXO1 template (Nakamura N, et al. (2000) Mol Cell Biol 20(23):8969-8982) and the following primers: GCGCGGATCCATGGCCGAGGCGCCTCAG (forward), GCGCGTCGACTTAAGCGTAGTCTGGGACGTCGTATGGGTATGCAGCTCTTCTCCTAGGAG (reverse).
The PCR product was gel purified, digested with BamHI and SalI, and then ligated into pBabe neo, which had been digested with BamHI and SalI and then dephosphorylated.
Proper citation: RRID:Addgene_45814 Copy
Species: Homo sapiens
Genetic Insert: hα1Ga
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-Express-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The Cav3.1 insert retains its STOP codon, so there is no expression of the Ds-Red. The 5'UTR is gone and contains a new SalI site. The 3' end of insert ends in the endogenous Kpn1 site.
Identification of Cav3.1 is described in Nature. 1998 Feb 26;391(6670):896-900.
Proper citation: RRID:Addgene_45811 Copy
Species: Homo sapiens
Genetic Insert: hE-cadherin/Δp120
Vector Backbone Description: Vector Backbone:pLKpac1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381089
Comments: The three-alanine substitution present in this plasmid prevent the hE-cadherin gene product from interacting with p120 catenin.
Alternate plasmid name: hE-cadherin-762AAA-pcDNA3
Proper citation: RRID:Addgene_45770 Copy
Species: Homo sapiens
Genetic Insert: vesicle-associated membrane protein 8
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45919 Copy
Species: Homo sapiens
Genetic Insert: GATA4
Vector Backbone Description: Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23591016
Comments: Please note that Addgene's sequencing identified R43Q, G50S and N197S mutations in the GATA4 insert in this plasmid when compared to GenBank reference sequence NP_002043.2. These difference were present in the original GATA4 sample and the plasmid functions as described in the associated publication.
Proper citation: RRID:Addgene_46030 Copy
Species: Homo sapiens
Genetic Insert: MEF2C
Vector Backbone Description: Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23591016
Proper citation: RRID:Addgene_46031 Copy
Genetic Insert: flp
Vector Backbone Description: Vector Backbone:pKD46; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24050148
Comments: Can be used to remove the integration module (including the antibiotic resistance cassette) from pOSIP integrants.
Reference:
St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j
Proper citation: RRID:Addgene_45978 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
