Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMP31-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45905 | mitochondrial antiviral signaling protein | Homo sapiens | Ampicillin | PMID:22427742 | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 4 | ||
|
pcDNA4 huZAP(S) Resource Report Resource Website 1+ mentions |
RRID:Addgene_45906 | ZAP(S) isoform | Homo sapiens | Ampicillin | PMID:18225958 | Contains a M202T and L388F amino acid change in the insert, not known to effect function. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | M202T, L388F | 2026-08-15 01:15:27 | 1 |
|
Tet-O-FUW-Zfp536 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45845 | Zfp536 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
pLPCX-VEcadTS Resource Report Resource Website 1+ mentions |
RRID:Addgene_45848 | VE-cadherin Tension Sensor | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 3 | ||
|
pLPCX-VEcadTL Resource Report Resource Website 1+ mentions |
RRID:Addgene_45849 | VE-cadherin | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | ||
|
Tet-O-FUW-Olig2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45844 | Olig2 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
Tet-O-FUW-Sox10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45843 | Sox10 | Mus musculus | Ampicillin | PMID:23584610 | Backbone Size:8377; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 3 | ||
|
pBADmod1-linker2-gamS Resource Report Resource Website 1+ mentions |
RRID:Addgene_45833 | gamS | Lambda phage | Ampicillin | PMID:24303785 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/His A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | ||
|
MG-miR125b-sponge-bulge Resource Report Resource Website 1+ mentions |
RRID:Addgene_45790 | miR125b sponge | Ampicillin | PMID:22366319 | Vector Backbone:MSCV EGFP (MG vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | |||
|
pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA Resource Report Resource Website 1+ mentions |
RRID:Addgene_45789 | deGFP | Ampicillin | Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||||
|
pBEST-pTar-UTR1-TetR-T500 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45780 | Tetracycline repressor | Ampicillin | Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||||
|
pBabe RFP-DN-FOXO1-HA neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45813 | FOXO1 | Homo sapiens | Ampicillin | PMID:21873240 | Backbone Size:5729; Vector Backbone:pBabe N-terminal RFP neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | aa1-255 | 2026-08-15 01:15:26 | 1 | |
|
pBabe HA-Runx1-neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45815 | Runx1 | Mus musculus | Ampicillin | PMID:21873240 | pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse). The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated. | Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | |
|
pBabe DN-FOXO1-HA neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_45814 | FOXO1 | Homo sapiens | Ampicillin | PMID:21873240 | pBabe DN-FOXO1-HA-neo was constructed by PCR using a pBabe FOXO1 template (Nakamura N, et al. (2000) Mol Cell Biol 20(23):8969-8982) and the following primers: GCGCGGATCCATGGCCGAGGCGCCTCAG (forward), GCGCGTCGACTTAAGCGTAGTCTGGGACGTCGTATGGGTATGCAGCTCTTCTCCTAGGAG (reverse). The PCR product was gel purified, digested with BamHI and SalI, and then ligated into pBabe neo, which had been digested with BamHI and SalI and then dephosphorylated. | Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | aa1-255 | 2026-08-15 01:15:26 | 2 |
|
hα1Ga-pDsRed Resource Report Resource Website 1+ mentions |
RRID:Addgene_45811 | hα1Ga | Homo sapiens | Kanamycin | The Cav3.1 insert retains its STOP codon, so there is no expression of the Ds-Red. The 5'UTR is gone and contains a new SalI site. The 3' end of insert ends in the endogenous Kpn1 site. Identification of Cav3.1 is described in Nature. 1998 Feb 26;391(6670):896-900. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-Express-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:26 | 5 | ||
|
hE-cadherin/Δp120 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45770 | hE-cadherin/Δp120 | Homo sapiens | Ampicillin | PMID:11381089 | The three-alanine substitution present in this plasmid prevent the hE-cadherin gene product from interacting with p120 catenin. Alternate plasmid name: hE-cadherin-762AAA-pcDNA3 | Vector Backbone:pLKpac1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Amino acids 762-764 converted from EED to AAA to abolish p120 interaction | 2026-08-15 01:15:26 | 2 |
|
pMRXIP GFP-VAMP8 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45919 | vesicle-associated membrane protein 8 | Homo sapiens | Ampicillin | PMID:23217709 | Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 1 | ||
|
tetO-GATA4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46030 | GATA4 | Homo sapiens | Ampicillin | PMID:23591016 | Please note that Addgene's sequencing identified R43Q, G50S and N197S mutations in the GATA4 insert in this plasmid when compared to GenBank reference sequence NP_002043.2. These difference were present in the original GATA4 sample and the plasmid functions as described in the associated publication. | Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | R43Q, G50S and N197S | 2026-08-15 01:15:28 | 6 |
|
tetO-MEF2C Resource Report Resource Website 1+ mentions |
RRID:Addgene_46031 | MEF2C | Homo sapiens | Ampicillin | PMID:23591016 | Vector Backbone:tetO-Gateway; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:28 | 4 | ||
|
pE-FLP Resource Report Resource Website 10+ mentions |
RRID:Addgene_45978 | flp | Ampicillin | PMID:24050148 | Can be used to remove the integration module (including the antibiotic resistance cassette) from pOSIP integrants. Reference: St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j | Vector Backbone:pKD46; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | flp driven by the constitutive promoter pE from phage P2 | 2026-08-15 01:15:28 | 15 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
